Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig44
Contig Information
Length 1050 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15f05    rwhcs15f05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 791
Evalue 4.30207e-134
Total Hit Count 335
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig44
CCCGATCCGTCCAAGTCGCCGACGGGGGGATCTTCGTCGCTCATCTTCCTGGGCACGGGCTGCTCCGGCGCGCTGCCCGACGCACGGTGCCTCCTCAAGC
CGTCAACGCCGCCCTGCGCCGTCTGCTCCATGGGCATCTCCCTCCCTCCGGAGGGGAACCCCAACTACAGGCTCAACACCTCCCTTCTTGGTAGACTATT
GCCCATGGAGATGGAACCCACAAGTACATCCTAATCGACATCGGCAAGACCTTCAGAGAGCAAGTTCTCCGGTGGTTTGTCCACCACAAAGTTCCTTACG
TTGACTCGATCATTCTGACTCATGAGCATGCAGATGCTGTATTAGGCCTTGACGAAGTCTGGGTGGTACAACCAAGAAATGACCGAAACGATGTCGAGAA
AATTCCTATCTTCCTCACACAATTCACGATGGACAGTATCGCGAGAAGATTCCCCTACTTGGTGGAGCAGAAGCCAGAGGATGGCGATGAAGATGCCCAA
GCCGCAAAAATCGAGTGGAAGATAGTTCAGGATGATGTTGAGAAACCGTTTGTAGCATCAGCACTAGAATTTGTGCCATTGCCGGTAATGCATGGAGAAG
GGTATATTTGTTTAGGCTTCTTATTTGGGAGGAGAGCCAGAGTTGCGTATTTATCTGATGTCTCAAGATTTCTACCTAAAACCGAGCATGAGTCTTGATG
CTATCAAGAGGATCCATCCTAAAAGAGCTCTGTTGATTGGAATGAGGCATTTTTTTGAGCATCAGAGAGAAAACCAGATGTTGGCAGAATGGTCTATCAG
AGAAGGAATACCGACACAACTTGCTCATGACGGCCTGCGAGTCTCCATTGACTTGTAATAAGGTATGCAAGGTTGCTATGCAATACTTGAGGACGACTAC
TTGGCACCTTTGAACAATTTAAATCATGTCAGTGCAGATTGCAGCATTCATATATCTTTTTCTGATTCAGCAAAGATCCACAATAGCAGTAGTTGTAGCA
GTTATTTTGTGATCTTTTATGTATCCAAAAGATTGTAAGTTTGCTCATGT
page-top