Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig564
Contig Information
Length 489 bp
Tissue Shoot grown with cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsc1a18    rwhsc1a18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0595400 [Oryza sativa (japonica cultivar-group)] >gi|20521311|dbj|BAB91825.1| unknown protein [Oryza sativa Japonica Group] >gi|20804631|dbj|BAB92321.1| unknown protein [Oryza sativa Japonica Group] >gi|113533000|dbj|BAF05383.1| Os01g0595400 [Oryza sativa (japonica cultivar-group)] >gi|125526673|gb|EAY74787.1| hypothetical protein OsI_02682 [Oryza sativa Indica Group] >gi|215697391|dbj|BAG91385.1| unnamed protein product [Oryza sativa Japonica Group]
Score 462
Evalue 8.10827e-45
Total Hit Count 106
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig564
CGCCGGCTCGGGGGACTTCGCCGTCGACCTGGACTCCAGCTGCCGCATCGTGCTGCCGGCGGGGAGCTACCTCGCCAACTTCAACGACCACCTCACCGGC
CACCTCGACGACCGTCGCATCTCCGGCCTCAGCGGCATCCGCGTCAGGGCTTTCTTCCGCTGGTGGTCCATCACCGGGATCCGCGCCGATGGAGACGAGC
TTGTCTTCGAGGTGGGCTCCGTCTCCGCCAAGTTCCCCGCCCGCCACTTCAACGCCAGCCTCGAATGCCCCGCCAAGGCCGACTCGTAGTACTATAACAA
GGAACTCTTGCGTGCCTCATGACACTGGCATACCATCAAGTCGCCTTGACGTCGAGCACTATGATTGTTTTTAATCTCTCACTGCCTTTGTAATTACTAC
TTGTGTATAAGTCTGGATCCCTAAGCCACCACTCCACTTTCGACACCAAGAAAGCGGGATAATGTAAAGGTTCTTCTTTAAAAAAAAAA
page-top