Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig38
Contig Information
Length 860 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15i11    rwhcs15i11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein FG08172.1 [Gibberella zeae PH-1]
Score 82
Evalue 3.51549
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig38
CCCCAAACCTCCACTGGGTTCCCACTCCATGCGGCTCTGAAATCTCCCATACATACTGCGCCCTGGAGCTGTGGCTCGGCGTCACCACCACCGCACCGCC
TCTCGCGCGCGTACGTCGCCGGCCGCCGCCGCGGTCCCCGTTGTACCTCATGGCGTCGCGGCTGCCTCCACCCCGATGGCGGTCTTGGACACTGGTATTT
GAGATAGACAGGACCAACTGCAAGGCAGCCGAGCCTCGCGGGCAGGAGGAGTTGCACACACATGGAGAGTTCAGACCGAGAGGATTCTGGCCACGGGGAG
CACCGTCGGCGCTGATTCGCCCATAGCAAAAATATGGTGTTATCCTGATTGAGCTTTTCTTCTACCCACCATCCTCCCCCTTCGTTTCCTCCTCTTCTTG
CTGCGTTGTTTGGGTCTTCTTGACCTTGCAAGACCTTTTCTTGACCTTGTAAGACCCAACAATGCCACATTTCCCCTCACGTTCTTCATCTTCTTATTCC
ACCTCCTTTCCCTGGCCATGTTCCTTTTCACCCCTCTCTCTTCCATCTTTCTTCCATCTATCCCTCCTGAGCTACATTTTCTTATAGTTGGATTTTTTAT
ATTCAAAGTATTGGGAACAAGATGATACCATGGAGTGACAAGTGAAGGAGATTCTACCTCCTTTGTCATACACGTGTGTAGATTCATCATCCCCACGTTG
TATTTTCCTCTTTTGTTTTGGTTGTAGAGAGTAAAGTTGATCAGATACAAAAGCACGGACCTTGTCGCCATAATGCTCATGCACGTGGAGTAGGAGCCTA
CATGTAATTGAGCATGTTTATGTATGCCAATGTTGTAATGAGTTTGCTATTCCTGCTTGA
page-top