Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig36
Contig Information
Length 1224 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15i04    rwhcs15i04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_002382 [Oryza sativa (japonica cultivar-group)]
Score 1079
Evalue 1.50385e-115
Total Hit Count 163
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig36
TCTCTCTCTCGCCGCCTGTACCTCGGCCTCTGGGACAAGTTCCCGGACACAAATGACCTTCCGAGCGGCGCCCACGTCTTCCCGCACCTTGCCGAGCTCG
GCTTCTGCAAAACCGACATCAAGACCAAGGACCTCGACCGCCTTCTTCAGTGCAGCCCCGTCCTGGAGAAGCTCGCGCTCATCCTCTGCTACGACACGCC
GCTCAACGTCCGCGTCCGCAGCCGCAGCCTCCGCTGTGTGCTCTTCTGGATGTCCCTCGCGGACGCGCTAGCCGTGGTCGTCGCCCCGTGTCTCGAGCGC
CTCATCCTGTGGAACGACTGCCCTGGTGCCTGGCTCGGCAAGGACTTTCGCACCAGAGTCAAGATTGGCTACGCGCCGGAGCTCAAGGTGCTCGGCTACT
TGGAGCCAAGCTTTCATGTGCTCGAGATCGGCAACACCGTCATCGAGTTTGGCACAAGGCCCAGCCCCACGACCACCATTCCAAGTCTCAAGATCCTGGC
GTTAAGGGTGCGATTTGGAGTGCGCAAAGAGGCTAAGGTGCTGCCTACCTTCCTCAGATGCTTCCCCAATGTCGAAACATTGCATGTCATGTCTGCTGAA
GCTGATGAGCCCACTGGCAAGCTGAATTTCAAGTTCTGGCATGATGTCGGACCCATCGAATGCCTGCAGTCACACACCAAGAAGGTGGTGTTCAAGAACT
TCCGAGGGAACCGGAGCGAGGTCGTGTTCCTCAGGTTCGTCGTGGAGAGAGCACAGCTTCTGCAAAAAATGGTGGTCGTGTTGGCAGATGGAGACCCTGC
TTCAGAGGAGAGGGTGGCGGCCAAGCTGAAAACTTTGGCTTGCAGCACCAAGCGTGCCAGCAGAGACTCGAAATTCTCAATCTTGGTGCGCAGCAGTGGG
GGCAGTGATTGGAGCTTCCGCGCAGCGTCCAATCTCTCCAAGAGTGACCCATTTGATAGCTGAAGCTGATCAAGGTGCTATCTGTAGCTGATATGTTTCG
ATCGTGATACATCATTGCCATTTCTTTTGCTAAGCTAGCAACATACTTTGCTTGTTTGAGTATCGCCTATCCGCTGGCAAGAGCGCTTATTTAGACTATG
AATTCTTGGCTTATGTTTTGTCTTGATGGTAGTAGAGTTTTCTGGTCCAGCAGCTAGATGGTCAGTAGTCCATGCAATGTCTGGTCCTGCTGAATTGTAC
CCAACTGGCTAAATGCAGACATTG
page-top