Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig35
Contig Information
Length 758 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15c17    rwhcs15c17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit mediator complex subunit 10 CG5057-PA [Zea mays] >gi|195639908|gb|ACG39422.1| mediator complex subunit 10 CG5057-PA [Zea mays]
Score 741
Evalue 1.06441e-76
Total Hit Count 134
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig35
CTCTTCCTCCTCCGCCGCCGCAACCGCCGCCGCCGTAGCGGCTGCGGCCGCTTCCGGTAACGGCCTACAAGGGGGCGACCGTCCCGAGGACCCGTCGAAG
CAGAACCTGGCGCAGGTCACGGCATCGATCCAGAGGACCCTGGGCCTGCTCCACCAGCTCAACCTCAACGTCTCCTCCTTCAGCTCCGCGTCCCAGCTCC
CCCTCCTCCAGCGCCTGAACGCGCTGGTGGCGGAGCTCGACACGATGCAGAAGCTCGCCGAGGAGTGCAACATCCAGGTGCCCATGGAGGTCGTCAATTT
GATCGATGACGGGAAGAACCCCGATGAGTTCACAAGGGACGTGCTCAACAGCTGCATCGCCAAGAACCAGATCACCAAGGGCAAGACCGATGCTTTCAAG
AGTCTGAGGAAGCATCTTCTAGAGGAGCTTGAAGAAGCTTTTCCTGAAGACATCGAAGCATACAGGCAGATACGTGCTACTTCTGCCGCTGAATCAAAGC
GGTTGGCTCAGTCGCAAAATGTTTTGCCTAATGGAGATTCCAGTGTGAAAGCTGAGCACTGACATAAGGACCCAAGACGCGAAGAGCAAGAAGCTCTCTA
GCTCTCCTATGCTTACAGTGTGAGGAAGGCCCTGGGAACAAACAACTGATACTATATCCCCTTGTACGCACTGGCCTTTTATAGGAGGGATCAATAGTAC
ATCTGTATATTATTGTCGCAATAATATATTCAACTTCCCATTTGTTGTAAAAAAAAAA
page-top