Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig33
Contig Information
Length 804 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15a10    rwhcs15a10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12184 [Oryza sativa Indica Group]
Score 137
Evalue 1.30021e-06
Total Hit Count 60
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig33
AAACACGTTGCGGAGTGTCGCGGCCTCCCAGTTCTTGGCCTCCGTCGGGTGGCTAGACCACGCCACATAGAAGACGAGGGTTATGTCAGTTAGGGGCCTC
GGCAACGACGACGAGAATGGCCAGGTCGAAATCACAGGTGCGTGACGGCTGGAGACGGCCGCAGGGTCCAGAGATGGGGCGCACGGCGGATGTGTTCTAC
TTCCCATTGAGAGAATTCTGGCCAAATCAGAGGATGCAGGTTGTACCATTGAAGAGAGAAAATTATGAGAAAACTACAATATATGAGAGGCTTGGTTGAT
ACCTTCAGAAAAGCTACATCCCAATAATGTTGTGGGTTACACCTTCTGGCTTGAAAATCAGCTTCATAACAAGAAAGTTGCAACACTATATTGGTGGATA
ATTGCATTAAATAAATGTTGTAATGGTGCATTTGTTTTTAGATTTCTATTAACCTGGTACCAAAAAGTTGGAGAGCAAGGACCTTATATCAGTGGTGTTT
ATACTCCAAAATTGCAGTATCGGTGGTGTTTATACTCCAAAATTGCAGTATCAGTGGTGTTTAGATTCCAAAACCTATCTAGAGTAATCTGTCATTTGTT
CTTCAAAGAGATTGCGTATCTGTTACCCCATGTCAGGTTCAGTACCTCTGGGTTCAAGATCTATAGCTACAAGTACTTTTGACTAGATTGTGGTCATATA
TGTGCTAATTCATGCTGATACGCATGCTCTTTGAACTTTTGAAAGGAATGGATGAAATCATCATCANAGCTTCTGCAAATGGGATCTCTCTTGTAAAAAA
AAAA
page-top