Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig32
Contig Information
Length 933 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs10e01    whcs19l13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative ankyrin repeat protein [Triticum aestivum]
Score 323
Evalue 4.58839e-28
Total Hit Count 58
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig32
CCCGGTGCGGCGGCGGCGGCGGCGCCGGCGCACGAGGTGAGAAAGATGCCGAGGGCTGTCAGGATCCGCGGCGACGAGCCGGAGACGGAGCGGAGAGCGA
AGAGGCGAAACGTGGCAGGGGAGGAGGAGGAGGAGGAAGGGACAGCTCTCCGCTCCACGAGCCCTAGATCTCCCGGCGACCGCGTGGATCGGAGGAGGAG
GAGGAGGAGGAGGAGGAAGGGAGCTGTTCGGACTTCCCACCCAGAGACGCTCTTCGCGGTCTTCGAGCCTGACAAAGATGAATCACAAGGAAAACAAGAT
CGTGTGTTCGACGATGTGGACGAGCCCGTGACGGAGGAATCCTCCGATCCGCCCAGCCCTCCGATCTACGAACCCTACATCCCCGACGATCTGGTTGATG
ATCCGGACATACTCGCTGCCTTCCACTACGCCAAGGCCAATTACGAAGCAGAAAAGTCTCGTCGAGCTAACCTCTTCACTATGGATCACTACGGTTATGA
AGCACCTTCTTGCTTGTTCGATGACCATCGCTTTCTACCTATTCGTGAACGGGCAACGGGTGCAGTACTTCTTGCTGCTAAATCAGTCGTTTTACTATCA
TCATTTATAGGGAGTCGGCCACTCAACAAGTGTTGTGGTTTGTGGTTTCAAAGGAACGATCAGAGCAAAACCGCCCATGTTCTCACGTCTGCGCATCTCA
TTCGTGAAAAGGATCCCTCCGTGAAGAACCATTGGAAATTGCAGTGGACAGGAAAATATCATCGTGGCGCTGAGGTCAATGTTCACTTCCTCGACAAAAG
AGTTGTACCAGGCCAACTCGTCTATCTTCAGGAGCATTATGAACTTGCTCTTTATGAGGTTGAAGTGAATAAACCAGTTCAGCTGCCCACTTTTAATGAC
TGTGTGCGTTCTGGTCAAGATGTTTTTCNACTT
page-top