Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig31
Contig Information
Length 677 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15a20    rwhcs15a20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13064 [Oryza sativa Indica Group]
Score 316
Evalue 1.62664e-27
Total Hit Count 63
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig31
AGCCCCCGGTATAGTTGACACCCTTGACCTAAGCATCCCAAGGAAGCTCCTTCTGTGGGTATATACATTAGTTCACGGTCGATATTGCAACATATCCGCT
GTCGTAAAGTACTGCGATGAGATGAAGGCAAGAAATAAAAGAGGAACCCTAACGGCGGCAGCTTCATCACAAGTCACGCCTCCAGCACCGCACAGCTCTG
TTTCTTCTCTGGTCACCTCCAAAGAAAAGAGTGCGCATACCGTGTCCAGTGAAGTTCAAGAAGCAAATGCCTCTGCTCCAGTAGCAGCCACTGTTCCTCT
CCACCAAGAAGCAGAGGGCAGCGCATCGCTGATTGCCACCGAGGCACAGAAACCCAGCACCGCGGCATCTCAACTGTCGCGCAGCAGCTCATCTAGGACA
ATGGAAAGTGCTCCGGATGGCGGTCAAGGCAATGCCGGTGCAGCTTGATTGTACATCATGCTTCTGTACACCCATGTGAGCTCCGCGGATGGTCATGAGT
TCTGATTAGATTGAAGGCTTCTTCCCTTCCAGCAGAAATATGATGTACTTACTGCAGTTGTAGCAGGACTAGGTCTGATGCCTTTCCTGGTGTATAAAAC
TAACATTGTATTAGAAGCTAATGTAACACTAAGGACATGCAAGTTCGGTGAGTGTTTGGTTGTAGCCAAAAAAAAAA
page-top