Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig29
Contig Information
Length 1045 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15h13    rwhcs15h13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1035
Evalue 1.49539e-110
Total Hit Count 364
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig29
TGATGAATCTGAAAGGAGAAGAGAAATGGCGAAGAACTCCCTTGAGAGATATACACATTATTATGAACGATGGGCAGCTAATCAGTCATCAAGGCAAAAG
GCATTAGGAGACCTTCAGAGTCTGCAAAATGACAAGCTTGAAAAGTTAAGTGATATACAAAGTCAACCTGAGTCACAGCTCAAGTTCATCATAGAGGCAT
GGCTACAGATTGTTGAGTGTAGGAGGGTATTGAAGTGGACATATGCTTATGGTTATTACCTCCCAGAGCACGAACATGCCAAAAGACAGTTTTTCGAATA
TCTGCAAGGTGAGGCTGAATCAGGTTTGGAGCGGCTGCATCAGTGTGCAGAGAAAGAACTTCAAATATACCTTGAAGCCGAGTCCCCCTCAAAAGATTTC
AATGACTTCCGTACAAAGTTGGCTGGATTAACTAGCGTGACTCGCAATTATTTTGAGAATCTTGTCCGGGCACTGGAGACTGGATTAAATGACGTTGGAC
CTTCTACTAGCCAAAGCACGGGCATCAAGAACACTACTTCTAAGAGCCTTGGTGGTAAGAGCAAGAGTGGTAAGAACAGGGCATCCGCTGCCGGCTCCAA
ATCAGGCAGCTCCAGCCGTGGCGTGGACGATAGCAACATTTGGACGTGTGATCAGTGTACATATGTAAACCCCAGATCGGCCAAGGCCTGCCAGGCTTGT
GACCACCAACACCGATAGCAGTAGTCAGTCCTTGTTTAACATCTTAGCTCCGTCGATCGAGAAGAATCCTCTCAGGTCATACAGCTGTGGTACCCAACAT
ATGCAAAAATTGCAGTTCTAAGGATATATGGGGCTACTGGAGTGAGGAGGCATCAGTAGAGTGCTGCATACAAAGGGAGGAGATTTGAATCTGCATTGTT
TGCCCACTGACTGACTGCACCGCCTCGCGGCACCATCCAGTTCGTTGTGTACATAAACTATATCTGTAACTCTGTTTTGTTTCGTTGATGTAGGGTGTAC
TAGGGGTGTGCTCCACCAGAGAACAAGTTTTTTCTGTTGTAATGC
page-top