Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig28
Contig Information
Length 1242 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15b13    rwhcs15b13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0444600 [Oryza sativa (japonica cultivar-group)] >gi|38344536|emb|CAE02442.2| OSJNBa0027P08.4 [Oryza sativa (japonica cultivar-group)] >gi|38344584|emb|CAE02431.2| OSJNBa0058G03.7 [Oryza sativa (japonica cultivar-group)] >gi|113564465|dbj|BAF14808.1| Os04g0444600 [Oryza sativa (japonica cultivar-group)] >gi|125590511|gb|EAZ30861.1| hypothetical protein OsJ_014344 [Oryza sativa (japonica cultivar-group)] >gi|215694007|dbj|BAG89206.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1341
Evalue 6.37541e-146
Total Hit Count 402
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig28
TTTTGACCCAGCTCAGGCCGTTTTTCTCACTGATTCCCAAGGCCAAGACTGCAAAAATTGTCCGTGGAATCATTGATGCTGTTTCCAAGATTCCTGGAAC
ATCTGATCTCCAGATCTCGCTGTGCAAAGAGATGGTGGAATGGACCCGTGCAGAGAAGCGTACGTTCCTTAGGCAGCGTGTGGAAGCAAGGTTAGCGGCA
CTTCTGCTAGAGAATCAGGAGTACACTGAAGCCCTGACTCTCCTTACTGGTCTTATTAAGGAAGTCAGAAGACTTGATGACAAGTTGCTCCTTGTGGACA
TAGACCTGTTGGAGAGCAAGCTCCACTTCTCTCTGAGAAACCTGCCAAAGGCCAAAGCTTCGTTGACTGCTGCAAGGACAGCGGCGAATGCCATCTATGT
TCCACCAGCTCAGCAGGGCACTATTGATCTGCAGAGTGGAATCCTTCACGCAGAAGAAAAGGATTACAAAACTGCTTACAGCTACTTCTTTGAAGCATTT
GAAGCTTTCAATGCACTGGATGACCCAAGAGCTATCTTCAGCTTGAAGTACATGCTCTTGTGCAAGATAATGGTTAACCAAGCTGATGATGTTGCTGGAA
TAATCTCATCTAAGGCTAGCCTAAAGTATGTTGGTCCGGATGTTGATGCTATGAAAGCTGTAGCTGATGCCTACTCTAAAAGATCTCTCAAGTACTTTGA
AACTGCCCTCCGTGATTTCAAAGCCCAGCTTGAGGAGGACCCTATTGTTCACAGGCATCTTTCCTCTTTGTATGATACCCTCCTGGAGCAGAATCTGTGC
AGGTTGATTGAGCCCTACTCGAGAGTGGAGATTGGGCATGTTGCACAGATGATTGAATTGGCGGTTGATGATGTTGAGAAGAAGCTGTCGCAGATGATTC
TAGACAAGAAATTTGCTGGTACTCTGGATCAAGGTGCTGGTTGCCTCATTATCTTTGAGGATCAGAAGACTGAGGCCATCTTCCCTGCTACACTAGAAAC
CATTTCAAATGTCGGAAAGGTCGTGGACAGTCTTTACATGAGGTCGGCTAAGATCATGGCTTGAAGGTTGCTAAGCATGTGATAGGCTGTTTGGTATGGG
TTCAGCCTTTTCAGTTCCTTTGCTGTCTTTAAGACATGTAATCCTGCATATTGGCACTTGATTTTGCATGTTGGTCGTTATATTGGATCATAGAAAAATC
CATCTTGTTCATGAACTGGACCAATTTGTTGTTTTTATGTGG
page-top