Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig26
Contig Information
Length 540 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15h02    rwhcs15h02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195604176|gb|ACG23918.1| ubiquinol-cytochrome c reductase complex ubiquinone-binding protein QP-C [Zea mays] >gi|195607900|gb|ACG25780.1| ubiquinol-cytochrome c reductase complex ubiquinone-binding protein QP-C [Zea mays] >gi|195611162|gb|ACG27411.1| ubiquinol-cytochrome c reductase complex ubiquinone-binding protein QP-C [Zea mays] >gi|195617026|gb|ACG30343.1| ubiquinol-cytochrome c reductase complex ubiquinone-binding protein QP-C [Zea mays] >gi|195618116|gb|ACG30888.1| ubiquinol-cytochrome c reductase complex ubiquinone-binding protein QP-C [Zea mays] >gi|195621702|gb|ACG32681.1| ubiquinol-cytochrome c reductase complex ubiquinone-binding protein QP-C [Zea mays]
Score 361
Evalue 5.70095e-33
Total Hit Count 23
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig26
CCACCCACCCCATCCCTGAGTTTGATCGGAGCCGGAGGAGAGCATCCACACCGAGGAAGAAGGAGAAGCGGCGAGGCGAGGCGAAAGATGGGGAAGATGC
CGGTGCGGATGAAGGCGGTGGTGTACGCGCTGTCGCCGTTCCAGCAGCAGGTGATGCCGGGCCTGTGGAAGGACATCACCACCAAGATCCACCACAAGGT
CTCCGAGAACTGGATCTCCGCCACGCTCCTCATCACCCCCGTCGTCGGCACCTACCAGTATGCGATGTGGTACAAGGAGCAGGAGAAGCTGTCCCACAGA
TACTAAAGGTGGAGCTTTCTCCAATATCGCAGCAGTTGGAATTTCCATGTTCTATAATCCACCAAGAGTGATTTAACATTTTCGGAATCACTTCTAGTTG
TACTCTTTTGCTCTTTCCGTTGCATATGCAATGATGCAGTAAGTGTGACTTGCAAACCTATTTTGAGGCCTCAAATGTTGAGTTGTCCATCACTGGAGTG
ATTTTGTGCAATAAAGCAAATTAACCAGTCAAAAAAAAAA
page-top