Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig24
Contig Information
Length 1275 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15c16    rwhcs15c16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09470 [Oryza sativa Indica Group]
Score 1252
Evalue 1.37406e-135
Total Hit Count 80
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig24
CAATGAGGAGAAGCACATGGAACGGTTTGCTGTACGCGCAAAGTACATGACACTGGACCCAGCAAAGAACAGATATATCAAGTACATCCGGAACATCAGG
GCTATCCAGGAGTACCTTTGCAACCGAGCAGACAAGCATCTGGTACCCAAAATTAACGACACTAACGTTGACCAGAGCGTGGCAGCGATACATGCCACGG
TTTTCAGCTGTCTTCGCCGGCGAGAAGTTGGGGAGCAGTTGTATGACCTCAACACAAACACCGTTCCTGTAGTGGATGAGGAATACAGGAACCAGCGTGC
AGCTAACTCCTTGGGTTCCAAGGGCATGTTCCAGCTCATTCAAAGGAAGGGGTCTTCGAGGAACCTGATGGCTCTCCTTAACCCTGATGGTTCGGTGACT
AAGGCTTGGCATGTAGATTCAGGTGATGGCAATGCTAATGGCAATACAGGCAGTGGTAGATCAGTAGGAAATCATATGGTTAACCCATCACTAATTGGGA
AGGCGGAGTCAGTTAATCTCCAGTTTGGTTCTTTCGGGATTAGCGCGTGGCTGAGTGACACAGGTGGCGGCACCAGCCATGCTGGAAGTGTAGATGACCT
GAGGGCTGATGGGATCGAGACAGGCGGTAGATACTTCTCCTCATGCTGCAGCTCACCAAAGACGTCAGACTGCGCCTCCAAAGAGCATATGGAGGATTAT
TCAGTCTATGGTAGTGAAGAGGATGCTGACGACCCACCTGACGCTGAAACTGATGAGGATCTAACTGATGAAGAAAGAGATGTTCATGAGATTGAAGCGG
GATCAGTCGACGAGCACTCCACCAAGTCTGACGAGGAGTACGATGACCTAGCGATGCAGGACGTGATGGGGAACGGCAACTGCTCCGACGACGACGAGCA
GGCTGCGGGGTACGGCGCCAGGAGGTCACCGCCCATGGAAGAGAGCATCCTCGGAGCAGATGACGCCATGGTGGAGGGCAGGTACCACCACAACCTGGAC
CTCTTCACAATGTCCAAGGACGTCGCTGCCACAAAGATGCCGTGCGCGTGACACCGCCGACCAACCCCTGGGGGAAGAAAAGCCGGTGGTGCCGTCCGGC
AGACACCACTGCCACGGTCCACTGTCAGCCGCGGTGCTCTTGGACACATTCTCCGGTGGTGCTTTCAGTTAGGAGTCTGCACCGGTTGCTGTACCCATAT
GAGCTTATGTTGTGGTTGTGACTGTTAGAGGACCTCATGCTTGGCTATATATAGGAATCCTGGGGCTCTGCCCTT
page-top