Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig23
Contig Information
Length 1077 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15g07    rwhcs15g07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100217250 [Zea mays] >gi|194698252|gb|ACF83210.1| unknown [Zea mays]
Score 632
Evalue 8.45752e-64
Total Hit Count 304
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig23
TCCCCCTATCCTCTCTGAGCCGAGTCCGATCTGCTGCTCTGCTCCTCCTGAAAGCAGGCCAAACAAGGCTCATCACTGAAAGAGGACTTCAAGTACATGG
CCTTTAAGACTCTGCAAGCTCCACCCAGTTTAGCAAGGCCAGACAGTTGCAGTTTCAGTCCCTCCAACTCCAAGTCTTATTGTTATCAGCCAAAACCTCA
CTCAAGACCGCAAGCAAGAATTGCCACGAAGAATCGCCTTCAGAGTTCACCAGTCCTGAAATGCAGAGCCAATCCGCGTGGCCACATCGACGAGGTTGTC
CAGCCCCATCAGGATCATCAGACTACTGAGATCCCCATAGTCCTGCACCAATCAGTCGTTTTCCCCGGCCAGACGCTGCAGATGCAGACGGTTGAGTTCA
GATATCGCATCATGATGCAGACACTACTACTCCAGGAAGGCCACAGCTTTGGTATCATCTACTCCAGCAGGAAAGATAGTAGGATGGCTGATGTTGGATG
CATGGTCCATATCGTTCAGGGCGATAAGCTCGTCAATGACCGCTTCTTCCTGACGTGCGTCGGCGGTGATCGGTTCCGTGTCCTGGAGGTCGTCAGAACA
AAGCCCTATGTCATCGCAAGAGTCCAGGTACTAAAAGACAGAGACTCGCCTGATTCAAGTAACCTGGGGTGCCTGATGCAGCAGGTGGAAGGGCACTTGA
AGGACCTGACAATGCTTTCAGACAAGCTCAGCTGGAAACTAATGGGAGACCAGGCTAGGCAGCTCAGCAGGATGCATTCTCCGGAGTCTTTCTCCTTAGT
CGTTGCTCGGTTGTTTATCGAAGATCGTTCAGAGCAGCAATGGTTGCTCGGATTAGATGATACAGCACAGCGGTTGGTGAGAGAAGAAATGTATCTTCAA
CAGAGGAGCAAGTACCTGGCAGCCGTAGCAGCGATTAGGGACGCATTTGGGCAACTGTCCTGCAATAAGAAGCAGTAGCAGACCTGGTGCATTGCAGCTG
CCATTTTGGTAATAGGAGTATGTTCGTGCTAGTGTGCTACATTGTAGTTTAATACTTACTTTGCTTCTGTCGTAATG
page-top