Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig22
Contig Information
Length 662 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15d20    rwhcs15d20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit F-box domain containing protein [Zea mays]
Score 174
Evalue 4.50455e-11
Total Hit Count 93
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig22
GAGAGCCTCGCCGACGGGAAGGACCTCGTGAGCGTGGAGAGCACCTGCACCGAGCTGAGGCGCTTCGTGGCCGACCGGGACCGCCAGCTCTGGCTGCCCA
GGTACAAGGCGCTGCCGGGGAACACGTTGTGGTGGTCGCTCCTCTGCGACATCGATTCCGACGACGACCTGCCGGCGGCGAGCTGGAAGGAGATGTTTGT
GTGGGCCACGCGACAGAGGGACCATAGGCTTGTTCTTCCTACTCCTAGTCCTTTCCGCAGTTCACCGTGGTATTCTTCCTTCAATGGACGGGTGGATGGT
GACGTAGAAGAAGACGATTCATTTGAGGAGCTGCCGGTGGATGCCGCTGCCTGCTTTGGAGAGATGATGACGGAGACGGAGGACGACGGGGAAAAGAATA
CCACCGGTCGCCGCCATGGCCATGGTAAGGCGCCCGCGACAGGCGGCCACGAGAAGCAGAAGCAGCAGGGTCGTCGCAGCCGCACCGGCACCGGCGCAAT
CTACTCCCCGTCTGCTAGGTACCGATGGAAACACAGGTGACCGGCCGGTCATCCTTTGCATGGAATTCCTTGCTCAGTTTGTTCAGAAACACCTGTCTTT
GAATGGCACAGTGAACTCTCTGTTGATCGATCACAAGAGTTCCTTTTTTTTTAAAAAAAAAA
page-top