Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig21
Contig Information
Length 490 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15e02    rwhcs15e02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit vacuolar H[+] ATPase 44kD C subunit, isoform E [Drosophila melanogaster] >gi|220902246|gb|ACL83133.1| vacuolar H[+] ATPase 44kD C subunit, isoform F [Drosophila melanogaster]
Score 82
Evalue 0.934284
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig21
GTTCTGAAAGTAACTGGTTGCACAGTGCTTGGTCTAATGGTTGTGCTTATGAGCTGGTACGTGAAAGTTCTACTGGAAGGCAGTTGATGCAAATGTGCCG
ACATGATCCTGAGTTTGAACTAGATCTTCCAAGCACAAGGTTCCTTTCTAGGCGAAGTCATACATGAACAGGTGGTCCTTGAAGTATATGGATACATATG
GTTTGGGTGCGATGGAAGCTGGCTTGAGAAGAGAGATACCGTTTAGCGTGTATGTTCTATTTCGCCATCGTAGCTGTGTAAATGTTTTCTTGCCTTGGGG
ATTCGAGAGACTCCTCTGTACATGATTTTGTAACTTGCCGCTGGTAGGTCTTTTGTGGTGCATAGAAAGCTCATGTTTTGGTGTGGGGTTTGTTGAATCA
AAAACTGAAAGCAAATGTGACAATCATCTATAGCTCAACTGACAATTGTTTGGCATCAAACTGAAGGAAGGTTTTTGACTAAAAAAAAAA
page-top