Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig20
Contig Information
Length 1337 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15e17    rwhcs15e17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit receptor kinase TRKe [Oryza sativa (indica cultivar-group)] >gi|218186178|gb|EEC68605.1| hypothetical protein OsI_36971 [Oryza sativa Indica Group]
Score 636
Evalue 1.49295e-113
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig20
GGGAATGAGATAACGGTTGATGATCTAACAAATGTGGCTGGTTACCAGATAGTCTCCTATCATGAGCTCATTCGTGCCACCAATAGTTTCAATGAAGAAA
ACATCTTAGGCTCAGGAAGCTTTGGAAAAGTCTTCAAGGGCCAATTGAGCACTGGTTTGGTGGTGGCGATAAAAGTTCTTGACATGCAGCTAGAGCAGGC
CATCCGAAGTTTTGACGTCGAGTGTCAAGTGCTTCGCATGGCACGACATCGCAACCTAATCAAGATACTCAACACATGTTCCAACCTTGACTTCAGAGCA
CTAGTGCTTCAGTACATGCCAAATGGCAGCTTAGAGACGCTCCTACACCAGTCTGACAGTTCATGGCACCTTGGGTTCCTTGAGAGACTAGGTATCATGC
TCGACGTGTCGATGGCAATGGAGTATTTGCACCATGAGCACTATGAACTGATCTTGCACTGTGACTTGAAGCCTAGCAATGTGTTGTTTGATGAGGAGAT
GACGGCACATGTGGCAGACTTTGGCATTGCAAGGTTGATTCTAGACGACAACTCCCATGATATCTGCGAGCATGCCTGGAACAGTTGGATATATGGCACC
AGAATATGGGTCTCTTGGGAAAGCATCACGGAAGAGTGACGTGTTCAGTTATGGAATCATGCTCCTTGAAGTCTTCACTGGAAGGAGACCCACCGATGCA
ATGTTTGGCGCACAACTAACCCTCAGGCAGTGGGTTCATCAGGCATTTCCTGCAGAGCTTGTCCGAGTCATTGATGGACAGTTACTGCAAGACTCCTCTG
CTACTTTCTGCAGCTTGGAAAGATGGCTTTCTTGCATCGGTGTTCGAGCTGGGTTTACTCTGCTCTGACGACTCGCCTGGCCAGAGGATGACAATGCATG
ATGTGGTTGTGACACTTAAGAAGATCAAAGGCGAGTACACAACAAAACACACAGCGACAATGTCACGTAATGTTGCATAGTGAGTTATCTCCATTGCACT
TGGAACACCCATAAGCGTCAGGGATGGGAAGGGATAAATCAAGATGCACACATATTATACACTTGGGATATACAACTATTTGATCATGCTTTTCTTCTCT
CAGACCATGAGAGGGATGATGTTGGATGCGCTTCACGGCACGGCTTGTCGCCTCACTTCACCGGCGTCCCCATGATGGGGTGGCCACTTGGTGGTCTTTT
TTCTTGCTTTCTTTGGGCGTGTTTGTGCCGAGGCCCCAGCAGAGGTTTTGTTTCGTTTGTGTGCTACTTGATGTTTGGACTGATTCGCCGAGAGTAGCAA
TCTCTTTAGATTATATTTTAGTTCCAAATAAATATAT
page-top