Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig19
Contig Information
Length 1034 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15e18    rwhcs15e18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0114800 [Oryza sativa (japonica cultivar-group)] >gi|27476097|gb|AAO17028.1| Putative transporter [Oryza sativa (japonica cultivar-group)] >gi|108705841|gb|ABF93636.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113547217|dbj|BAF10660.1| Os03g0114800 [Oryza sativa (japonica cultivar-group)] >gi|125584682|gb|EAZ25346.1| hypothetical protein OsJ_008829 [Oryza sativa (japonica cultivar-group)] >gi|215694509|dbj|BAG89502.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1166
Evalue 5.67362e-130
Total Hit Count 123
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig19
TGGCCTCTTTGCTAACCTGCTCGCTGACAACTTGGGCTTTGGCCCTGCTGGCTCCTTTCGATGCCGCCGCGTGCTTCCTGGCAATAGGCATGGCTATCAT
AATGTCCTCATGGAGTGAAAACTATGGAGATCAATCTGAAGGCAAGGATCTCATGTCTCAGTTCAAGGTTGCCGCCAAGGCAATCGCTTCAGATGAGAAA
ATTGCATTGCTGGGAGCCATTCAGTCGTTGTTCGAGGGCTCCATGTACACTTTTGTCTTCCTCTGGACTCCAGCGTTGAGCCCAAATGACGAAGACATTC
CTCATGGCTTCATATTTGCCACCTTCATGCTGTCGTCTATGCTGGGTAGCTCCATTGCATCACGCCTGTTGGCCCGGAAGATGAAGGTCGAAGGTTATAT
GCAGATCGTGTTTGCAGTATCAGCCTTCACCCTTTTCCTCCCGGTTGCCACCAGCCTTCTGGTGCCGACGTCTTCAGTGAAAGGAAGCGGCATCTCGTTT
GGGGGCTCTCTACAGCTGCTTGGTTTCTGTACCTTTGAGTCGTGCGTCGGCATTTTCTGGCCATCCATCATGAAGATGAGATCTCAGTACATTCCTGAGG
AGGCGAGGAGCACCATCATGAACTTCTTCCGCATACCGCTCAACCTGTTTGTCTGTGTGGTGCTCTACAATGTGAATGCTTTCCCTATCACCGTCATGTT
TGGCATGTGTTCCATCTTCCTCTTGATGGCGGCAATCTTGCAGAGACGGCTCATGCTTGTCGCTGACCTACACAAGCTATCCACAAAATCACAAGATATG
ACCGCGGAAGACGAGCCTCTAAATCCTTGAAAGGCCAACAGAACACATGCACCTGGGTGCTGGCTGAATAAGATGGAATTGGGGAAAGCAAAATATGTTT
TGATTGTAATATTTCTTTTTTCTGTAGCGTAGATCAGATCGATATTATTATTGGCTAGGCACGATCGAGGACATGGATGGATGGATACACCAAAGCAAGA
ATTCAGAGGCTGCTGAGTGAATTGGTATAGTCTA
page-top