Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig17
Contig Information
Length 759 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15e22    rwhcs15e22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit polyubiquitin 2 [Deschampsia antarctica]
Score 677
Evalue 2.80759e-69
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig17
GAGAAAAGAAAGGATTTTCGTTTCGTTTTCGTCCGCTTCCGCCTCTGCTCCGTCGTCCTCACGCGACCTGCAGCTTGACTCCCTCCCGCACCGCACGCAC
GAGCAGCAGGGGCGCGAGAAGATGCAGATCTTCGTCAAGACCCTCACGGGGAAGACCATCACCCTCGAGGTCGAGAGCAGCGACACCATCGACAACGTCA
AGGCCAAAATCCAGGACAAGGAAGGGATTCCTCCGGATCAGCAGCGTTTGATATTCGCTGGCAAGCAGTTGGAAGATGGACGCACGCTTGCTGACTACAA
CATTCAGAAGGAGTCGACTCTTCACTTGGTCCTCAGGCTCAGGGGCGGTACTATGATCAAGGTTAAGACTCTCACTGGGAAGGAGATCGAAATCGACATT
GAGCCCACCGACACGATTGATAGGATCAAGGAGCGTGTTGAGGAGAAAGAAGGCATTCCTCCTGTGCAGCAAAGGCTGATTTATGCTGGTAAGCAGCTTG
CAGATGACAAGACTGCCAAGGACTACAACATCGAAGGTGGCTCGGTCCTCCATCTTGTCCTTGCTCTGAGGGGTGGTTACTAGTTAAGCTGTAATGGAAA
CGCTTGCGTCCTGAGAGAAGTGACCATTGGTGGCATGGAACCTGTGTTGCAAAGAGATAATAACAAACTAGCTTTGCTTAGTGGGAGGGGCTGTCTTCCA
TGTTATCTGCCTATATGATTTGACAAAACTACTCGCAAGTTTATCTGCCAAAAAAAAAA
page-top