Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig16
Contig Information
Length 536 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15f12    rwhcs15f12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_018964 [Oryza sativa (japonica cultivar-group)]
Score 343
Evalue 6.71083e-31
Total Hit Count 201
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig16
AGATTGCCTCCATTGAAATTAATCACAAGCCAAGTTGATACAGCCACAAAAGGGCAAAAGGTGGCTATAAAGATCATTGGGAGCAACTCTGATGAGCAGC
AGAAGAGCTTCGGCAGGCACTTTGAGATGGAAGATGAGCTGGTCAGCCACATCACAAGGCGATCCATCGACCTTCTTAAGGAGAACTACAGGGATGACTT
GACGATGGATGACTGGAAGCTTGTGATGAAGCTCAAGAAAATACTGAGCATACCGTGAGTTTGACAAAGCCGGCACGACGTCAAAACCACCTGGCGGAAT
GGATAAATTGACGCTTTTGAGAGTGCATATATGAATTGACAAGGGTGGTGGTATTCTTGTTTTGTTGCTTGGGCTTGGGTTGCAGCTGTTTGAGACATTT
GGCCTCACTCATGTTAGCCATGGAGGGTGGTTTCAGTTTTGACGATTTTGTAATTTGGTCCCTCGACGTTACGCCTAACTTTACGAATCCATCCTGTAAT
AACAGCAGCAGCAGATTTTCGTTTCCAAAAAAAAAA
page-top