Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig13
Contig Information
Length 865 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs4f09   
Homology (BLAST) Top Hit polyubiquitin containing 7 ubiquitin monomers [Zea mays]
Score 1118
Evalue 2.60429e-120
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig13
GATGTACCTGCAACTGTTTTGCACCAAACCACAGGACTCGATGGTCCATTAAAGCAGCAGACACAGTACGACTTCACACAAACGAGACATCACTTGAACA
AAGGCGACACAGGGTACAGCAGCAGCAGCAGCAGGTCAAACGATAGGGCAATTACTGACCACCACGGAGGCGGAGCACCAGGTGAAGGGTGGACTCCTTC
TGGATGTTGTAGTCGGCTAGGGTGCGACCATCCTCCAGCTGCTTGCCAGCGAAGATAAGGCGCTGCTGGTCCGGGGGAATGCCCTCCTTGTCCTGGATCT
TAGCCTTGACATTGTCAATGGTGTCAGAGCTCTCAACCTCAAGGGTAATGGTCTTGCCAGTGAGGGTCTTCACGAAGATCTGCATGCCACCACGCAGACG
CAGCACCAGGTGGAGGGTGGACTCCTTTTGGATGTTGTAGTCGGCCAGGGTGCGACCATCCTCCAGCTGCTTGCCAGCAAAGATAAGGCGCTGCTGGTCC
GGGGGAATGCCCTCCTTGTCCTGGATCTTGGCCTTGACGTTGTCAATGGTGTCGGAGCTCTCGACCTCCAGGGTGATGGTCTTGCCAGTGAGGGTCTTCA
CGAATATCTGCATGCCACCACGCAGACGCAGGACAAGGTGGAGGGTGGACTCCTTCTGGATGTTGTAGTCAGCGAGGGTACGGCCATCCTCCAGCTGCTT
GCCAGCGAAGATGANACGCTGCTGGTCCGGAGGAATGCCCTCCTTGTCCTGGATCTTGGCCTTGACATTGTCNATGGTGTCANACGACTCAACCTCAAGG
GTGATGGTCTTGCCTGTCANTGTTTTCACAAANATCTGCATCTGCAAANAANAATCNCATGGACA
page-top