Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig12
Contig Information
Length 564 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs2g17   
Homology (BLAST) Top Hit hydrolase, carbon-nitrogen family [Zea mays]
Score 763
Evalue 1.5316e-79
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig12
GCAAGCGGACAGCGCGGGCCGAGGAAGGGGTAGGTGAGGAGGGGAGATGGCCGGCGCGGGGAGGAAGGTGGCAGTCGCCGCCGTGCAGTTCGCCTGCACC
GACACGGTGGCCGACAACGTCGCCGCCGCCGAGAGGTTGATTAGAGAAGCTCATAAGAAAGGCGCGAACATTGTCCTCATTCAGGAGCTATTTGAGGGGC
ACTATTTCTGTCAGGCTCAAAGGATGGATTTCTTTGGGCGTGCCAAGCCTTATAAAGAGAACCCGACTATAATGAGAATGCAAAAGCTTGCAAAGGAGTT
GGATGTTGTAATACCTGTAAGTTTCTTTGAAGAAGCGGGCAATGCTCATTACAATTCCGTGGCCATTATTGATGCTGATGGCACCGATCTTGGCCTATAC
CGCAAATCACACATTCCAGATGGACCAGGTTATCAAGAGAAATTTTATTTCAACCCGGGTGACACTGGATTCAAGGCTTTCAAAACCAAGTATGCAACAA
TTGGTGTTGGAATTTGTTGGGACCAGTGGTTTCCANAGACCGCAAGGGCTATGGTGCTACANGG
page-top