Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig11
Contig Information
Length 635 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs15g04   
Homology (BLAST) Top Hit RecName: Full=Histone H3.2 >gi|55977043|sp|P68428|H32_WHEAT RecName: Full=Histone H3.2 >gi|55977044|sp|P68429|H32_MEDSA RecName: Full=Histone H3.2; AltName: Full=Histone H3.1; AltName: Full=Major histone H3 >gi|55977045|sp|P68430|H32_ONOVI RecName: Full=Histone H3.2 >gi|19607|emb|CAA31964.1| unnamed protein product [Medicago sativa] >gi|19609|emb|CAA31965.1| unnamed protein product [Medicago sativa] >gi|21797|emb|CAA25451.1| unnamed protein product [Triticum aestivum] >gi|488565|gb|AAB49545.1| histone H3.1 >gi|2565419|gb|AAB81995.1| histone H3 [Onobrychis viciifolia] >gi|195605922|gb|ACG24791.1| histone H3 [Zea mays] >gi|195611126|gb|ACG27393.1| histone H3 [Zea mays] >gi|195622802|gb|ACG33231.1| histone H3 [Zea mays] >gi|217075590|gb|ACJ86155.1| unknown [Medicago truncatula]
Score 673
Evalue 5.66094e-69
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig11
CGCCGCCGCACCCGATCTCCCAAGAACACACCACCACCAGAGCCGCCGACCCCCAATCCCCGATGGCCCGCACGAAGCAGACGGCCCGCAAGTCCACCGG
CGGCAAGGCGCCCAGGAAGCAGCTCGCCACCAAGGCTGCTCGCAAGTCGGCGCCGGCGACCGGCGGCGTGAAGAAGCCCCACCGCTTCAGGCCGGGAACC
GTCGCCCTCCGTGAGATCCGCAAGTACCAGAAGAGCACGGAGCTGCTCATCCGCAAGCTCCCCTTCCAGCGTCTGGTGCGGGAGATCGCGCAGGACTTCA
AGACCGACCTCCGCTTCCAGTCCTCCGCCGTCTCTGCGCTGCAGGAGGCCGCCGAGGCGTACCTGGTGGGGCTGTTCGAGGACACCAACCTGTGCGCCAT
CCACGCCAAGCGCGTCACCATCATGCCCAAGGACATCCAGCTCGCCCGCCGCATCCGTGGGGAGCGCGCCTAGGTTCGTCCTGGTCGCCGGTAATGCTTG
CTAGCTGTTCTTGTCGTGTGATCCTGGTGTGTGCCTGGTGCTTCTGTTTGTCGGTGTCGATATGATGTGTCATCTGGTCCTATGTATGGTGATGGTCGAA
TGAAATTGCAATGGAAAGTTCAGTTAAAAAAAAAA
page-top