Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig10
Contig Information
Length 774 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs18o19   
Homology (BLAST) Top Hit hypothetical protein OsI_18129 [Oryza sativa Indica Group]
Score 809
Evalue 1.0334e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig10
TTCGCCACCACCGCCGCCACCAACCCCCTCATCCTCTTCCTCCGCTCTCGGCAGCTGCCGCTCATCTCGGTGGGAGGCCCTCAGGCGGGCAGGTTCCCCT
AGATCCCCGGAGTCACTCAATCAAATGGCTGACGGTGAGGACATCCAGCCCCTTGTCTGCGACAATGGAACTGGCATGGTCAAGGCTGGTTTTGCAGGGG
ATGATGCACCCAGGGCCGTCTTCCCAAGTATCGTTGGGCGCCCCCGCCACACTGGTGTGATGGTGGGGATGGGGCAGAAAGATGCATATGTTGGTGACGA
GGCCCAATCCAAGAGGGGTATCCTCACCTTGAAGTACCCGATCGAGCATGGTATCGTCAGCAACTGGGACGACATGGAGAAGATCTGGCATCACACTTTC
TACAACGAGCTCCGTGTTGCACCTGAGGAGCACCCAGTACTTCTGACTGAGGCACCCCTGAACCCCAAGGCTAACAGGGAGAAGATGACACAAATCATGT
TTGAGACCTTCAATGTTCCAGCCATGTATGTGGCCATCCAGGCTGTGCTTTCCCTATATGCCAGTGGACGCACAACAGGTAATTGTCGTTGCGAGCACAC
ACATTCTAAAATGTAAGCTTCATCTTCAATCTGAGCTGGGAAATAAATGTTGTTTTTCCAGGTATCGTGTTGGATTCTGGTGATGGTGTCAGCCATACTG
TGCCAATCTATGAAGGATATGCCCTTCCACATGCCATCCTTCNTCTTGACCTCNCTGGGGCGCGACCTAACTGA
page-top