Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig9
Contig Information
Length 763 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs10f19   
Homology (BLAST) Top Hit protein pob [Zea mays]
Score 890
Evalue 5.6647e-94
Total Hit Count 208
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig9
ACGACGAGCTCTCCCCTCTCGTCCCGTCTCCTCCCCCTCGCGACGCCACCGCCGCGTCGCCGGTCGCCGGCTCGCCGCCCCAGGTAGGACGTAGCCAGTC
ACCCCGCCCGGCCCCGATGGCTGAGGAGCTGGTGCTGGACACGGCGATCCGGGACTGGGTCCTCATCCCGCTCTCCGTGGTCATGGTGCTCATCGGCGTG
CTCCGCTACTTCGTGTCCAAGCTCATGCGCTCCCCGCCGTCGGCCTCGCCCTCCCCCGACCCCAAGACCGTCAAGGAGGGGCAGGTCGTCATCAGGGCGA
GGAACCTGAGGAACGGCGCGCAGTTCATCCCGGCCAAGGCCTTCAAGGCTCGCAAGCTTTATTACACCAACGGGGAAGCAGGATTGCTTCATGTTCCTAA
AGAGGATGCCCAGAAGGCTCAGGCGGCTATGTTTTCGGACCCAAACATGGCCATGGATATGATGAAGAAGAATCTCTCCATGATAGTTCCACAGACACTT
ACATTTGCATGGGTGAACTTCTTCTTTTCCGGTTTTGTTGCAGCCAAAATCCCCTTTCCATTGACTCAACGATTCAGGGGAATGCTGCAAAATGGGATAG
ACCTGAGTACTGTTGATGTGAGCTATGTTAGCAGCCGTTCATGGTACTTCCTCAATTTATTTGGCTTGAGGGGTCTTTTCAGTCTCATCCTTGGTGAAGA
AANTGTTTATGCAGCTACTGATGATGCCCAAAAGATGATGGCNATGGGTGGTGGAATGGGCTT
page-top