Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig8
Contig Information
Length 301 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs17o18   
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera] >gi|157338623|emb|CAO41974.1| unnamed protein product [Vitis vinifera]
Score 98
Evalue 0.0129504
Total Hit Count 26
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig8
GTTAACCGAACATCGCCNACACNACGACANCGAAAACACAGACCCACCCACAGGCACCACGGCCCGGGNCAGCGCACANTAAACAAGAAAAGAACTATNC
ACCATATATATGGTTTTTGCTCGAATCAGCAGAGTAATATANGGGCAGTTGAATGTGTCTCACGACCTCGACTTGTCCTCACTTCTTGCCGCAGTTGAAT
CCGTGGCACACCGACAGGATTATGATGAGGATGAGCGCGACGATGATGCCCAGGACGATCAGCTTGATCTTCATGTTTTGTAGCCACATCTTTCTCCTCA
C
page-top