Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig6
Contig Information
Length 846 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs17a12   
Homology (BLAST) Top Hit Os07g0171300 [Oryza sativa (japonica cultivar-group)] >gi|34394436|dbj|BAC83610.1| putative casein kinase 1, delta isoform 1 [Oryza sativa Japonica Group] >gi|113610532|dbj|BAF20910.1| Os07g0171300 [Oryza sativa (japonica cultivar-group)] >gi|215694741|dbj|BAG89932.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218199164|gb|EEC81591.1| hypothetical protein OsI_25061 [Oryza sativa Indica Group]
Score 1134
Evalue 3.50901e-122
Total Hit Count 90
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig6
ACATGCATTCGGTTTTACNATTAGGTCGAATTAACCATCACATCAACTTCTGCTTTTGAATCCTATCATGGCAATTCTCTTGTATCTCACATCAACTGAT
GCTCATTTGCCAAAGTAGTAAACGTCCCTCTCTTGGTCAACTGACAGTTCTCCCGTAGCAGATCGAAGCAATGTATAGATTCTTGGCCCATTTATCCTTT
ACATGGTTGCTGGGAAAGGCTGAGGTCCGTAGAGTTTCTTGTGTCTCGTCTACTGGTTTCCGTTTTGGCTTGCTCAAGATAAAAGCGGCTTGATCACCGG
TAGCTGCTGAAGAAGTTATTCTGTAACCATGCTCCCATCGCCGATGGATGCCTTCACTTGGATACAGGAAATCCAACTCAACAATCTGTTCAGAATAGCC
AGAGTTCCTTGACATGACTACTCCCCAGCGATTTCCAGCTGTGGCCATAGATGTTACATGAAAACCTTCTTTCCACTTTTTATTGATCCACTTGAAGGGG
AATGATTCGCTAACCTTGTACGATTGTTGAGTGTAAGGAGTTCCTTTAGACATTAAAACCAATGAACTTCCGTTCAATGCTCCAGCTATTGCTGTTATGT
AGAAACTTTTCTCCCACTGATCCATTATCCAGTCCTTGTGTAGAAAAACAGGTGAGAGTTCATAAACCTGAGAACCGAAATCAGTTCCTGCATCCATAAT
GAGAGCCCAAAGGTTTGCTGAAGAAGCCACACAACTGATGTATAGACCATCCTCATTACCCTTTTCTATATGCTGTTGAAGCCTGTTGTCAGCAACATTG
TAATGATACCGCTGCTTCATAGGGGCGCCTGGCATTGTAAACTGAA
page-top