Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig5
Contig Information
Length 833 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs7f20   
Homology (BLAST) Top Hit unnamed protein product [Arabidopsis thaliana]
Score 389
Evalue 1.55372e-45
Total Hit Count 415
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig5
CGTCTTCCCCGTCGCCGTCGTCCTCACGGTCCAGCCCTCCGGCCGTCACTGATCGTCGCCGGCAGACAATGTGGGGCGAGAGGGCTCATCACAGGCATGG
GCACCATCACGACCACGTTCCGTCCGGGGGTTCCAGGGACCGGCAGCCCAAGTTCATAGCAGACAACTACAGCTCGGTGGATGAGGTCATCGCTGCATTG
AGAGAAGCTGGGCTTGAATCATCAAATCTAATTCTTGGCATCGACTTCACCAAAAGCAATGAATGGTCAGGTAGGCATTCCTTTGGAAGAAAATCTCTGC
ATGCCATTAGTGGTACCCCAAATCCATATGAGCAAGCCATCTCTATAATTGGGCGGACACTATCACCTTTTGATGATGATAACTTGATACCATGCTTTGG
ATTTGGTGATGGTAAGTATTCGCTCACTGTTTTTGGCTTTTCCATTGTAACTTTCCTTAAAGGAATTTGGCACCTCTTCCATGACTTGATGAAATGCAAT
TCAACCTGTAGCTTCTACACATGATCATTCAGTCTTCAGCTTTTACCAAGAAAACCGCCCTTGTCGTGGTTTTGAGGAGGTTCTTGACAGATACCGACAA
ATTGTTCCACATTTGAACCTTTCCGGTAATGAGGGCTTATTCCCTTTTTGCCTCCAGTAGAGATTCTGGGATTGTAAAACGATAACAAATATGAGTTTTA
TTTGCCCCAGTAACTTTGACAGTGGAGACAGTCTTTTTCTAATCAACAAACTGTTTTTAGGACGACTTATGTTTTAAAGTAACCATATAGTGCTATGCTT
TGTTTCTTTGCTTCAACTTATTTGATGGCGTGC
page-top