Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig4
Contig Information
Length 785 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs12g04   
Homology (BLAST) Top Hit hypothetical protein OsJ_004737 [Oryza sativa (japonica cultivar-group)]
Score 645
Evalue 1.55008e-65
Total Hit Count 456
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig4
AGCAGGCAGCAAGGGGTCTCCCCGGCCGTCTTCCCCGTCGCCGTCGTCCTCACGGTCCAGCCCTCCGGCCGTCACTGATCGTCGCCGGCAGACAATGTGG
GGCGAGAGGGCTCATCACAGGCATGGGCACCATCACGACCACGTTCCGTCCGGGGGTTCCAGGGACCGGCAGCCCAAGTTCATAGCAGACAACTACAGCT
CGGTGGATGAGGTCATCGCTGCATTGAGAGAAGCTGGGCTTGAATCATCAAATCTAATTCTTGGCATCGACTTCACCAAAAGCAATGAATGGTCAGGTAG
GCATTCCTTTGGAAGAAAATCTCTGCATGCCATTAGTGGTACCCCAAATCCATATGAGCAAGCCATCTCTATAATTGGGCGGACACTATCACCTTTTGAT
GATGATAACTTGATACCATGCTTTGGATTTGGTGATGCTTCTACACATGATCATTCAGTCTTCAGCTTTTACCAAGAAAACCGCCCTTGTCGTGGTTTTG
AGGAGGTTCTTGACAGATACCGACAAATTGTTCCACATTTGAACCTTTCCGGTAATGAGGGCTTATTCCCTTTTTGCCTCCAGTAGAGATTCTGGGATTG
TAAAACGATAACAAATATGAGTTTTATTTGCCCCAGTAACTTTGACAGTGGAGACAGTCTTTTTCTAATCAACAAACTGTTTTTAGGACGACTTATGTTT
TAAAGTAACCATATAGTGCTATGCTTTGTTTCTTTGCTTCAACTTATTTGATGGCGTGCACGCCAGGCCTCCCGACCCCTCCCTG
page-top