Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig3
Contig Information
Length 896 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhcs14p18   
Homology (BLAST) Top Hit hypothetical protein OsI_06455 [Oryza sativa Indica Group]
Score 724
Evalue 1.34872e-74
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig3
AATACATCATCCCTTGCAACGTGGCACGAGCATGGAGTCATGGACCATAGGATGGCTTTATCACATAAGTTCAGTTTTTATAGATCTCGGCAGGAAATGA
CCCAACTTCAGGACGGGCCTTTCAAATAAAGTTGGCAATAATCCATTCAGATCACCAGTACAAACTGCAGCGCTACTTGACCGGGAGCTTATGTTGTCTG
TTCTGAACTGGATGACTGCTTTCTTCCTTCAATGTGGATGAATAGTTGGGAGTTTTTGCACAAGGATTTCTCTCAAGATATATGGTGGTCAGTTTCTCTC
GTGAACCAGACAAAGCAGATTCTATCCCAGACAGTGATGGTATTTGGTTGTCATTCAACCACAAGTCCTCTAACCTGGTTAATGGCTCAATATCTTCGAT
AGCGGTTAGTTTGTTAGATGAAACATCTAAAACACGAAGGTTCTGTAACATAGAAAGGCCTTCCATCTTTTGGATTCCATTATGGCTGAGATACAGTTCC
TCTAACGCAACACATTCTTGTAAGCCATTCATTGAAGTTAGCCTGTTGCTTTGCAGACTTATTTTTTTGATTGATTTCAACCCACATAAGTTGATAGTCC
GGATCCGGTTTCTTCCGAGCCATAACTCCTGTAGATTTGTCAAAGTTTCCAGATTTTCCATCACCCTTAATCTGTTGCTACCAAGTTCAAGCAATTCTAA
TGCATGGAAATGTTCAAGTTCTTCCATCTTTGGAACCTCATTCTTCNAAAAGTANAGTTCTTTCACTGTGCTGGAAACCTTGGATAACCCATTTAAGGGA
CGACAACTCATTGAAAGAAACATCAAACACCANAAANACCCTTGAAGATGCTGGCATCNGGGGATCTTTATAANCTTGTTATCTCTAAGGACTATC
page-top