Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2
Contig Information
Length 768 bp
Tissue Callus
Clones 1 Clones [Download: CSV  ,  FASTA ]
whcs7f18   
Homology (BLAST) Top Hit Os05g0207500 [Oryza sativa (japonica cultivar-group)] >gi|53749328|gb|AAU90187.1| putative shaggy-related protein kinase [Oryza sativa (japonica cultivar-group)] >gi|113578452|dbj|BAF16815.1| Os05g0207500 [Oryza sativa (japonica cultivar-group)]
Score 1177
Evalue 3.02513e-127
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2
ACCCTAGCCACATGGAGCATCCGGCGCCGGCGCCGGAGCCGATGCTGCTCGACGAGCAGCCCCCCACCGCAGTCGCCTGCGAGAAGAAGCAGCAGGATGG
CGAGGCGCCGTATGCGGAGGGGAACGACGCCATGACCGGTCACATCATCTCCACCACCATCGGCGGCAAGAACGGCGAGCCCAAGCAGACGATTAGCTAC
ATGGCGGAGCGCGTTGTGGGCACTGGTTCGTTTGGCATCGTCTTTCAGGCTAAATGCCTGGAAACCGGGGAGATGGTGGCCATTAAGAAGGTACTGCAGG
ACAGACGAGATGAGCTGTTTCTGAACCTTGTCATGGAGTATGTCCCGGAGACGCTGTACCGCGTGCTTAAGCACTACAGTAATGCCAAACAGGGGATGCC
ACTTATCTACGTCAAGCTTTACACCTATCAGCTATTCAGGGGGCTGGCGTACATTCATACTGTTCCAGGAGTCTGTCACAGGGATGTGAAGCCACAAAAT
GTTTTGGTTGATCCTTTAACACATCAAGTTAAGATCTGCGACTTTGGAAGCGCGAAAGTTCTGGTGGCGGGTGAGCCCAATATATCATACATATGCTCAC
GCTACTACCGTGCTCCGGAGCTTATATTTGGTGCGACTGAATATACAACATCGATAGATATATGGTCAGCTGGTTGTGTTCTTGCAGAACTGCTCCTTGG
TCAGCCATTATTTCCAGGANAGAGTGCANTCNATCAACTCGTANAGATAATCAAGGTTCTTGGAACGC
page-top