Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig165
Contig Information
Length 201 bp
Tissue Shoot grown with cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsc1d23    whsc1d24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein 57h21.24 [Brachypodium sylvaticum]
Score 335
Evalue 4.29249e-30
Total Hit Count 88
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig165
TGTACCTGCGCTATGCCGCGGACCCAAAGACCTTATGGACCTGGTATGAGCCCTACATTCAAGATGATGAGGAGTTTTCCCCTGGATCCAATGGTAAAAT
GACTACTATGGGCGTTTATGTGCGTGATGTCATCCTTGGTCAGTACTACTTCGACAGTCTTTTTCCACGAGTGCCTCTCCTAATTCTGCGACAGGTTACT
G
page-top