Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig156
Contig Information
Length 933 bp
Tissue Shoot grown with cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsc17g13    rwhsc17g13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_010136 [Oryza sativa (japonica cultivar-group)]
Score 160
Evalue 3.6525e-09
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig156
GTGCCATCCCTCCCAGACCACTCCCCCGAGCACCCTCCGCCGCCCCGACGACCATTCGCCACCAGCCCCGCCGCTCCCTGGAGATCCTCCATCGAGCAGC
GCCGTCGCTTCCAGGAGATCCAGCCCGAGAAGCGTCGCTGCTTCCAGGAGCTCCTGGCACGGGCAGCGTCGCTGTTTCCAGAAGCTCCGTCCCGCCACGT
CTTCGTCCTCTCCCCCAAGAGCGCCGACTACATCCTCTCCCCCGAGCAGATGCCGCTTCTGCGTTCTTTCACACGAGCAGTGCCGCGTCGACTACATCCC
GGTCTCCTCTACTTCCTCACCCCAACCCGCAAGCTACCAAAGAAAAAGAGAAAGATGCCGAGGTCCTGCGGTGGCTAGGGTTGTGCGCACTGGTGTTGCC
TATGCGAGCGACACGGGGTGAGCAACTAGGAACCAAAAGATGCCGACAGTATTGAGTAGTCAGATCAGCAAACCTGTGTTGGTAGTTCCATCACTGAAAC
GAGTTCAACAAGTTTTGTCTCAAGCTTGTAAGTTTTGTCACGAGGAGGAGATTGTTAGAATGCTACAGAACTTCTACTACATGATAGTAGTTGGACCAGT
CAACTAGGATGCCCACATGATGTTTCTTGTATTCATAGCAACAACAGAATCATGTGGGGCGAGGTTAAGCTGTGATCTTCAAAACATTGCAAGTTTGGTG
ACTCTTCTGCGAGAGACATGTGGCCCTCTTTGAAGGATGCAGTTTCACAGGATGGTGGCGAGTCAGTTATTCACAAGACATCTAATAAAGCCATCCAACA
AACGGCTGCGAACGAGCAATTTGTCTTCCTGAACATGGCTGTAGCTGTGCGTCAAGCTCAAACCATTTGTTTATCTTAGTTTTGAACAAAAGAAATCTTA
TTGTCTTATGTAAATTCTGTTTACCCGATGTAG
page-top