Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig131
Contig Information
Length 814 bp
Tissue Shoot grown with cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsc1b11    rwhsc1b11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0636800 [Oryza sativa (japonica cultivar-group)] >gi|77557181|gb|ABA99977.1| Ubiquitin-conjugating enzyme family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113649874|dbj|BAF30386.1| Os12g0636800 [Oryza sativa (japonica cultivar-group)] >gi|218187313|gb|EEC69740.1| hypothetical protein OsI_39266 [Oryza sativa Indica Group]
Score 841
Evalue 3.09096e-88
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig131
TTCCCTTCCTCTCCACGGACCCGAACGCGCCATGACGAGCTCCTCCACGCCGTCCCGCAAGGCGCTGAGCAAGATCGCCTGCAACCGGCTGCAGAAGGAG
CTCGCCGAGTGGCAGGTCGGCCCGCCCGCCGGCTTCAAGTACAAGGTCTCCGACAACCTCCAGAGATGGGTGATCGAGGTGGGCGGCGCCGAGGGCACGC
TCTACGCCGGCGAGACGTACCAGCTGCAGGTCGACTTCCCCGAGCATTACCCCATGGAGGCACCTCAGGTCATTTTCCTCAACCCGGCGCCGATGCACCC
GCACATTTACAGCAACGGGCACATCTGCTTAGATATACTGTATGACTCGTGGTCGCCTGCGATGACTGTAAGTTCAGTCTGTATCAGCATTTTGTCGATG
CTGTCTAGCTCGCCAGCAAAGCAACGCCCGGCGGACAATGATCGCTACGTTAGGAACTGCCGCAACGGGAGGTCGCCCAAGGAGACCCGATGGTGGTTTC
ATGACGACAAAGTATGAGGGGCATCGAATCAATTGGCTCTTCTGGCCACCCCATACTCGCCAGCCAGCCTTCCTTACCGTGAAAGAAATCTCTTCCAAGG
GGAGATGAGATGAGATGATTTAGGCTTAAAAATTTAAGCTAAGCAACCCCTCTATCGTACTGCGGATCTTAACATGCTGTGGTGGTTTGTACATGAGCTC
AACACATGTTGTCGAAACGTGAATATATCATCGGTACCGACGATGAGAGATATATAGAATAAGCAAGTGTAACCTGTCGATGCGCTGGTACAGGCACAAA
AGGAATGCAGATTA
page-top