Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig36
Contig Information
Length 1051 bp
Tissue Shoot grown with cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsc1b05    rwhsc1b05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0891400 [Oryza sativa (japonica cultivar-group)] >gi|57899790|dbj|BAD87535.1| ALM beta-like [Oryza sativa Japonica Group] >gi|113534586|dbj|BAF06969.1| Os01g0891400 [Oryza sativa (japonica cultivar-group)] >gi|125572934|gb|EAZ14449.1| hypothetical protein OsJ_004274 [Oryza sativa (japonica cultivar-group)] >gi|215768884|dbj|BAH01113.1| unnamed protein product [Oryza sativa Japonica Group]
Score 711
Evalue 5.26355e-111
Total Hit Count 209
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig36
CCTGAGCAATGGAGTCGAGGAAGCCGCAGCGCTCCGCTCTCGTCGACAGCTATGTGGTCCCCGGCGACGTCATCCTGGACCTCGCCGACATGACCAACCA
GACCATCAAGCTCGGCGCCGGTCTGCGCCAGGATTGTGACACTATCCAGGCAACTAGTGCTGGGAGGCTTCGACTGTCCAAGCCCAACAAGTACTGGGTG
GAGAACTCCCAGAAGAGGTATGTACCTTCTGTAGAAGATACGGTTCTTGGTATTGTAGTTGACACCAAACCAGATAACTTCTTGGTGGACATAAAGGGGC
CTAATTTGGCCTTTTTACCAGTTCTTTCATTTGAAGGTGGTACAAGGAGGAACATACCAAAGTTTGAGATTGGTACATTAATATATGCCAGAATGGTGAA
AGCAAATAGCATTATGAATCCAGAGCTTTCATGCATGGATGCAAGTGGAAAAAGCTGCTGAATTTGGTCAACTGAAAAGTGGTTATACGTTTGAAACATC
AACTGGCCTGGCAAGAATGCTTTTAAGTTCCCCAACATGTCCACTTCTAGAGGCCCTTGGGAAAAAACTATCATTTGAGATAGCTGTTGGACTGAATGGT
CGAGTATGGGTGAATGCTCCTTCGCCAAGTAATGTCATTGTTGTATCAAGCGCAATAAAAGAATCAGAATCTTATAGTCGCTTACAACAAAAAAGCATGG
TGGAAAAACTCCTGGCTAAACTGTCATGATGGGAGCAGGATATAATCAGGCACTGTAAAAGGATTCTGAATTATTGTTTGTCAAACGCCGCAGATGATTC
TGTAACCGGAAAGATGGCTAGTCACTAGCATGCACCTTAGCAAGGAATAGTAGATGGGATGGCATGTAAAATAGACGCGTTAAAGTGGTTGGTGCTTTTT
GATGATGTAGGGGTTAAAGCAACCGGTTGATTGGTAAACATTCTAAATGACCGTGTGGATGTTGTACTTGCGGATAACATGGTTTCTTAGCTATGTAATA
TGCTACCGTAAGAGATTTGCACAAGGCTGCGTGTGCTGCTCTACGAAAGAT
page-top