Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2680
Contig Information
Length 2181 bp
Tissue Root of dessiccated seed
Clones 35 Clones [Download: CSV  ,  FASTA ]
whrd10b24    whrd10e19    whrd1p05    whrd2e02    whrd3h08    whrd4e01    whrd4m07    whrd6k13    whrd8f02    whrd8f11    whrd11p17    whrd12b20    whrd12e03    whrd13j13    whrd13j14    whrd14d13    whrd14i04    whrd17f23    whrd18h13    whrd20d16    whrd20k03    rwhrd10b24    rwhrd10e19    rwhrd1p05    rwhrd3h08    rwhrd4e01    rwhrd4i02    rwhrd4m07    rwhrd8f02    rwhrd12b20    rwhrd13j13    rwhrd13j14    rwhrd14d13    rwhrd17f23    rwhrd20d16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0276500 [Oryza sativa (japonica cultivar-group)] >gi|108707463|gb|ABF95258.1| Heat shock cognate 70 kDa protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548183|dbj|BAF11626.1| Os03g0276500 [Oryza sativa (japonica cultivar-group)] >gi|125585779|gb|EAZ26443.1| hypothetical protein OsJ_009926 [Oryza sativa (japonica cultivar-group)] >gi|215706307|dbj|BAG93163.1| unnamed protein product [Oryza sativa Japonica Group]
Score 3102
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2680
TGCTCCGCTCCAAGATCCAACCAATCCCGCAATTCCCTTCGAGGTTGTTTCTCCGCTCGACTTGTCGACGAGATCATGGCCGGAAAAGGAGACGGGCCGG
CGATCGGCATCGATCTCGGCACCACCTACTCCTGCGTCGGCGTCTGGCAGCATGACCGGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACGCC
GTCCTATGTCGCCTTCACCGACACCGAGCGGCTCATCGGCGACGCCGCGAAGAACCAGGTCGCCATGAACCCGATCAACACCGTCTTCGATGCGAAGCGG
CTCATCGGTCGGCGTTTCTCGGACGCGTCGGTGCAGAGCGACGCCAAGCTGTGGCCGTTCAAGGTGATCCCAGGCCCCGCTGACAAGCCGATGATCGGGG
TACAGTACAGAGGCGAGGACAAGCAGTTCTCGGCCGAGGAGATCTCCTCCATGGTGCTCAACAAGATGAAGGAGACGGCCGAGGCCTACCTCGGCACAAC
CATCAAGAACGCAGTCGTCACCGTCCCCGCCTACTTCAACGACTCCCAGCGCCAGGCCACCAAGGATGCAGGCGTCATCTCTGGCCTCAACGTCATGCGG
ATCATCAACGAGCCTACCGCCGCCGCCATCGCCTACGGTCTCGACAAGAAGTCCACCAGCGTCGGCGAGAAGAACGTGCTCATCTTTGATCTCGGCGGCG
GTACCTTCGATGTCTCGCTCCTCACCATTGAGGAGGGTATCTTCGAGGTCAAGGCCACTGCCGGAGACACCCACCTGGGAGGCGAGGACTTCGACAACCG
GATGGTCAACCACTTCGTGCAGGAATTCAAGAGAAAGAACAAGAAGGACATCAGCGGCAACCCGAGGGCGCTCCGGCGGCTCAGGACAGCGTGCGAGAGG
GCGAAGAGGACACTCTCCTCCACCGCCCAGACCACCATCGAGATCGATTCCCTCTTCGAGGGCATCGACTTCTACACTACCATCACCCGCGCCCGGTTCG
AGGAGCTCAACATGGACCTCTTCCGCAAGTGCATGGAGCCCGTTGAGAAGTGCCTCCGGGACGCCAAGATGGACAAGAGCACCGTGCACGATGTTGTCCT
CGTCGGAGGATCCACACGTATCCCCCGTGTGCAGCAGCTCCTCCAGGACTTCTTTAACGGGAAGGAGCTCTGCAAGAGCATCAACCCTGACGAGGCCGTC
GCGTATGGAGCCGCCGTTCAGGCTGCCATCCTCACTGGCGAGGGCAACGAGAAGGTGCAGGACTTGCTCCTGCTTGACGTCACACCGCTCTCGCAGGGCC
TGGAGACGGCCGGAGGTGTCATGACCGTGCTGATCCCAAGGAACACGACAATCCCCACCAAGAAGGAGCAGGTCTTCTCCACCTACTCTGACAACCAGCC
CGGCGTGCTCATCCAGGTGTATGAGGGCGAGAGGGCGAGGACCAAGGACAACAACCTGCTCGGCAAGTTCGAGCTCTCCGGGATCCCACCGGCGCCCAGG
GGTGTCCCCCAGATCACCGTGTGCTTTGACATTGATGCCAACGGTATCCTGAATGTCTCGGCGGAGGACAAGACCACCGGACAGAAGAACAAGATCACAA
TTACCAACGACAAGGGGCGGCTGAGCAAGGAGGACATCGAGAAGATGGTGCAGGAGGCCGAGAAGTACAAGGCTGAGGACGAGGAGCACAAGAAGAAGGT
GGACTCCAAGAACGCCCTGGAGAACTACGCTTACAACATGCGTAACACCATCAAGGATGACAAGATCGCCTCCAAGCTCCCAGAGGCCGACAAGAAGAAG
ATCGAGGATGCTATCGATGGTGCCATCACCTGGCTCGACAACAACCAGCTCGCCGAGGCTGAAGAGTTTGATGACAAGAGGAAAGAGCTGGAGGGCATTT
GCAACCCCATCATCGCCAAGATGTACCAGGGTGCCGGCGCTGAAATGCCTGGTGGCATGGATGAGGATGCTCCGGCCAGTGCCGCAGGCGGCAGCAGCGG
CCCAGGGCCCAAGATTGAGGAGGTCGACTAAATGATAGATTTAGATCGCCTACTATTCTGCTTGAATAATGTGTCTTTCATTGTACGGTGGATTCTAGTA
TCGTTCTGCAGTTTTTCGTTCGGGCATATATACATTGCCCCATCTTATGTTTAAGTTGATATTGAAACACGATTATTTAGT
page-top