Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2675
Contig Information
Length 1669 bp
Tissue Root of dessiccated seed
Clones 23 Clones [Download: CSV  ,  FASTA ]
whrd10d09    whrd10d10    whrd2l02    whrd4j03    whrd5n18    whrd5p16    whrd6o03    whrd9i22    whrd11b12    whrd15h07    whrd15i22    whrd17d06    rwhrd10d09    rwhrd10d10    rwhrd2l02    rwhrd4b16    rwhrd4j03    rwhrd5n18    rwhrd5p16    rwhrd6o03    rwhrd15h07    rwhrd15i22    rwhrd17d06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|396134|emb|CAA80666.1| protein synthesis elongation factor-1 alpha [Hordeum vulgare subsp. vulgare]
Score 2233
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2675
CTTTGACCCCATCGCCCCTCCGTCCTCTTCGTCTCCGGTAGGCCAGGTAGTTAACAGCTCCAGCAGCCATGGGAAAGGAGAAGATCCACATCAGCATTGT
GGTCATTGGCCATGTCGACTCTGGCAAGTCAACCACGACTGGCCACCTCATCTACAAGCTTGGAGGCATTGACAAGCGTGTGATTGAGAGGTTTGAGAAG
GAAGCCGCTGAGATGAACAAGAGGTCTTTCAAGTATGCCTGGGTGCTTGACAAGCTCAAGGCTGAGCGTGAGAGGGGTATCACCATTGATATTGCTCTGT
GGAAATTCGAGACCACCAAGTACTCCTGCACTGTCATTGATGCTCCTGGTCACCGTGATTTCATCAAGAACATGATCACCGGGACCTCCCAGGCTGATTG
TGCTGTGCTTATCATTGACTCCACCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTCCTTGCTTTCACTCTTGGT
GTGAAGCAGATGATCTGCTGCTGCAACAAGATGGATGCCACCACTCCCAAGTACTCGAAGGCCCGTTATGAAGAAATTGTCAAGGAAGTCTCTTCATACC
TGAAGAAGGTTGGTTACAACCCTGACAAGGTTCCCTTTGTTCCCATCTCTGGGTTCGAGGGTGACAACATGATTGAGAGGTCCACCAACCTTGACTGGTA
CAAGGGCCCCACCCTTCTCGAGGCCCTGGACCAGATCAATGAGCCCAAGAGGCCCTCAGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATT
GGCGGCATTGGAACTGTGCCAGTGGGCCGTGTTGAGACTGGAGTCATCAAGCCAGGCATGGTTGTCACCTTTGGTCCTACTGGCCTGACCACTGAGGTGA
AGTCCGTTGAGATGCACCATGAGTCTCTCCTGGAGGCGCTTCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGGCTGTCAAGGATCTCAAGCGTGG
GTACGTCGCTTCCAACTCCAAGGACGACCCTGCCAAGGAGGCTGCCAACTTCACCGCCCAGGTCATCATCATGAACCACCCCGGCCAGATCAGCAACGGC
TATGCCCCGGTGCTGGACTGCCATACGTCCCACATTGCTGTCAAGTTTGCTGAGATCCAGACCAAGATCGACCGGCGGTCTGGCAAGGAGATTGAGGCGG
CGCCCAAGTTCCTCAAGAACGGTGATGCTGGGTTCGTCAAGATGATCCCCACCAAGCCCATGGTGGTGGAGACCTTTGCCCAGTACCCTCCCCTGGGCCG
CTTTGCTGTGCGTGACATGAGGCAGACGGTTGCCGTGGGTGTTATCAAGGCTGTGGAGAAGAAGGATCCGACCGGTGCCAAGGTGACCAAGGCTGCGGCC
AAGAAGAAATGAGATGGTGTCAGGTTCTTTACTGCATCTATGGTGGCGGTGGCGGTATTTGGTGGTGGTGATAGTTGTTCTAGTTGTTTTGGAAACTTGT
TAAGCTTCGGTTATTTGTGTCGAGCAGTGTTGGAACTGCTTATTGCTCTGTCATTGTATCGTTCGGTTGTGTTGGTGAAACTTCGTCAGTTAATGTTGCT
ACTATATATAGTTGGCATGTTTGGAGTCGTTTTATATCAGTTGATCATGTTTTTCGTCTAAAAAAAAAA
page-top