Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2667
Contig Information
Length 1443 bp
Tissue Root of dessiccated seed
Clones 20 Clones [Download: CSV  ,  FASTA ]
whrd10a12    whrd10a23    whrd4m12    whrd6c16    whrd6f12    whrd8e03    whrd8e04    whrd8e15    whrd11c07    whrd18l01    rwhrd10a12    rwhrd10a23    rwhrd4m12    rwhrd6c16    rwhrd6f12    rwhrd8e03    rwhrd8e04    rwhrd8e15    rwhrd11c07    rwhrd18l01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit BAX inhibitor 1 [Hordeum vulgare subsp. vulgare]
Score 1026
Evalue 2.62876e-109
Total Hit Count 291
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2667
TATTGCAACCAAACACGCCCTAAAACTGGCGGACGCGGCAACCACGTTGGGGAAAAACTAGTTTTACAGCTCTACTATCAGATGCCTGGCCGAAACGCGG
CGGCAGGTCCAGGGCAAGTTGGATGTGCCAGTCGAGCCAACTACCTGGAAACACGACAAGAGAAGAGCACAGGTGAACATCACAATCGGACAGGCCTTGC
TCAACAACCTGCAGTACCAACATGTGTTGGACAATTTGTTCAAAAGAAATGAGACACATCACAAGGTTAAAACCAACGAGCCACAATCGAGCGTAGCCAT
GTTCTTCGCAACCAAACCAAATCGTCTCAGGTTTCGATTATCGAGACAGTAACAGGAACGCAAGAGATCCGGAACGCAGACAGCGTCTGCAAAAGCTTCA
TCAGCAGCAGCAAACTCACACAAGGTTCACACGACACAGATCGCGAATTAACAAGGGTGGCACGGCGACAAGTTACTGCGCCAGCTTAATTCCTACAAGT
ACTTAGCAGTGGAGGTGGTACCAGTAGCGGCGGCGGCGGTGATGGTATCTACGATGTGCAGAGGACAACACGTTCAGGACCTCCTCTTCCTCTTCTTCTT
GTCCTCCGACTTGTCGCCTGCGTTCTTGAGCATGATGATGAGGATCCGGACGAGGACGGCGACAAAGTCGGTGAAGAGGGTGAGCGCGTGCTTGATGTAG
TCCATGTCGCCGTGGTGCGCCCTCTCGATGATCTCCTGCGTGTCGTACACCATGTATCCCAGAAAGATCAACAGGCCAAAGTAAACCTCAAACATGAAGC
TGCCAGAGGAGTGGCCAAAGATGGACGTGGCAAACTGCAGCCAGAGCAGGATCGACAGGCCGGAGGAGAGCAGGCCACCGAGGTACAGGTACTCCCTGCG
CTTGGCGATGATGGCGGCGCCAGAGAAGCACCCAAAGGCGATGGCGGTTCCAACAAACCCTGTCACGAGGATGCTTGGGTCAAAGTCTATGGCAAGCTCA
ATCAGAGGTCCAACCGAAGCCCCTTCCAGGAGGGCTGCACCCATCAGCAGCCCAAACCTCTTCCTCTCCTCATAGACTGGCACAGAGAACATCCAGGCAA
TGGTTCCGATACACGCAAGCATTGTCAGCATCCCACCGATGTTCAGGGCAATGTGCAGGTAAGCACCCACGGCAGATGAGGCCAGGGCAAAGCATAGGGT
CAGGTAAACGAGCTTGAGGTGGGACTGCGCGGCGGGGGAGATCTCGCGGAAGTTCTTGAGCGAGTCGTAGCCCCATCCGCTCGCCGCCGCCGACGAGGTC
GAGTAGAAGGCGTCCATCCCTGCCCTGCGTCTGTCGAATCGGAGCGGCCTCGCCTCGCCTCGCACGCAAAGCTGCCTTGGCCTTTGCTCGCGCTTCCGGA
TGGATTTTTCTCTTTTCCTTTTCTTCTTCTTCCGCTGCTTGGA
page-top