Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2666
Contig Information
Length 1159 bp
Tissue Root of dessiccated seed
Clones 18 Clones [Download: CSV  ,  FASTA ]
whrd10a15    whrd1f10    whrd2f18    whrd3i06    whrd6o21    whrd13o12    whrd15n10    whrd16n07    whrd19h05    rwhrd10a15    rwhrd1f10    rwhrd2f18    rwhrd3i06    rwhrd6o21    rwhrd15n10    rwhrd16n07    rwhrd19f13    rwhrd19h05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Dehydrin COR410; AltName: Full=Cold-induced COR410 protein >gi|457389|gb|AAA20189.1| cold acclimation protein >gi|157153570|gb|ABV24865.1| dehydrin WZY1-2 [Triticum aestivum]
Score 620
Evalue 2.31487e-62
Total Hit Count 158
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2666
TGCACAATATGTACTGGGCGGAAATCTTTAATATCAAGGCATAATGCCCAGCAATAAACCAATACACAAGTGCCCATAAGTAAACAAACTTGACAACATC
CAGGACCTGACTCTGAACCAAACTGAAACAGAAGCACCCGTCACTGAACGGGCTTCACGGACCGGACCTTCAAAGACGATCAACCCCTCCCACCTTGACA
CCAACTTAGACGTAAAGCAAACACAACACACGCCAACAATTCAATCGAGGTCCGGTCACGGGTCTCGGGCACGGCGGCGATCAAGCGCTGGGCTTGTGCT
CGCCTGTAGCGGCGGCGGCCTTGTCCTCCTCCCCTGTCTTGTGGTAACCAGGCAGCTTGTCCATGATCTTGCCCAGCAGGCCCTTCTTCTCCTTCGCGTC
AGGGCTGCTCACCTCCTCGGGGGCCGGCGCCGGCGCGTGCACTGGTGCTGGAGCAGCGTGCGTGACGGGCACCGCAGCAGCGTCCTCCGGCTTCTTGTGG
CCGCCGGGCAGCTTCTCCTTGATCTTTTCCAAGAAGCCTTTCTTCTCCTCCTCGGGCACTGCCGGTGCCGCCTCTGTCTTCACGTCGCCGTCGATCTTCT
CGACGACGACGTCGGTGTCATGGTGGCCGCCGTGGGTCTGCACAGACGCGGGGGCCGCCGGTGCCGGTAGCCCCGTCACGTGCTCACCCTCGGTGTCCTT
GTGGCCGGGCAGCTTCCCCTGGAGCTTTTCCTTGAGCCCCTTCTTCTTCTTCCTCTTGATCACCTCGCCGTTGTCATCGATCACCTCCTCTTCTTCCTCG
TCACTAGACGAGCTGGAGCTGGAGCTGGATCGGTGCAGCTTGGAGAAGAGGGTCTCCTTCTTCTCGCCATCCTCGTGCTCCTCCTTCTTGACCTCGGGCT
CTTCCACGGAGACCTTCTCCATGCCGGTGACCAGCTCCTCCTCCTTCTCCTTGTCCTCCTCAGCCTTCTTCTTGCCGAGGAGGTTGCCGAGGAGGCCCCT
GTCCGTCACCTCCACCTGCTCGGCGGCCTCACCTCCCTGGTACGACTGGGTGCTCCTCTCATCCTCCATGATCGAGATCGATCGGTGCAGCTAAAAGTCT
TCCGGGAGCTAAAGGAAACAACAGATCAAGTATTGGTTCTTGGCTTGTGGCTTTGCTTG
page-top