Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2656
Contig Information
Length 958 bp
Tissue Root of dessiccated seed
Clones 15 Clones [Download: CSV  ,  FASTA ]
whrd10e09    whrd2m03    whrd4p24    whrd11e17    whrd13o16    whrd15i01    whrd16b22    whrd19o15    rwhrd10e09    rwhrd2m03    rwhrd4p24    rwhrd11e17    rwhrd13o16    rwhrd15i01    rwhrd16b22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutathione-S-transferase 19E50 [Triticum aestivum]
Score 1123
Evalue 8.14953e-121
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2656
TCTCTCTCACAAACACAGTCACACACAGACACACACCCCGAATCCCTCACTCCCTCGCGTGTACTAGCAACCAAGGGAAACAATGGCGCCGGTGAAGGTG
TTCGGGCCGGCGATGTCGACCAACGTGGCCCGGGTGCTGGTGTGCCTGGAGGAGGTCGGCGCCGAGTACGAGGTGGTCGACATCGATTTCAAGGCCATGG
AGCACAAGAGCCCCGAGCATCTCGTCAGAAACCCGTTCGGCCAAATCCCTGCCTTCCAGGATGGGGATCTGCTTCTCTTCGAGTCACGCGCAATTGCGAG
GTACGTGCTCCGCAAGTACAAGAAGAACGAAGTGGACCTGCTGAGGGAAGGCGACCTCAAGGAGGCGGCGATGGTGGACGTATGGACGGAGGTGGACGCG
CACACCTACAACCCGGCCATCTCGCCGATCGTGTACGAGTGCCTCATCAACCCGCTCATGCGCGGCCTGCCGACCAACCAAACGGTGGTGGACGAGAGCC
TGGAGAAGCTCAAGAAGGTGCTGGAGGTCTACGAGGCGCGCCTGTCCAAGCACGACTACCTCGCCGGGGACTTCGTCAGCTTCGCGGACCTCAACCACTT
CCCCTACACCTTCTACTTCATGGCCACGCCGCACGCGGCCCTCTTCGACTCGTACCCGCACGTCAAGGCCTGGTGGGAGAGGATCATGGCGAGGCCGGCC
GTGAAGAAGCTCGCCGCGCAGATGGTTCCCAAGAAGCCGTGATTTGCTAGGCGGGATCTCGCATCGTGGGATCCGATTCCGATCACTGATCTGTGTGGCG
TTTTCTTTTCTTGTTGGTGTCGCGAATAAGGCAAATGAGCTCGTGTGTGTGTGGCTGGAATTGCACCAGCGTGCAGTTTTTGCGCTTTGCGTGTGTGTGG
TCGTGAAAACTCTTGAGATGGAACAATGTCTTCGTAATGCTTTCAGATTTGTCGCTGG
page-top