Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2653
Contig Information
Length 1578 bp
Tissue Root of dessiccated seed
Clones 15 Clones [Download: CSV  ,  FASTA ]
whrd3c15    whrd8p16    whrd11d19    whrd11f06    whrd13e18    whrd17c08    rwhrd2p05    rwhrd3c15    rwhrd4k18    rwhrd6d22    rwhrd8p16    rwhrd11d19    rwhrd11f06    rwhrd14c24    rwhrd17c08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08713 [Oryza sativa Indica Group]
Score 1770
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2653
TTTTTTTTTTGGATGTCAAGACCAACAGCATAAACTTGGACCATAATAATCTCAGTAGGATTGGAGGACAATGTATTTAAGGAAAATTGCCCAGTAACGA
TTCAGGGCACATACTCGAACTCAAACTCAACCCCTATGATAGTAAATGTTTTGAGAACGCTGCCGCCAACCTACGACAACCTCTGGAGTTCGATGCCTCC
ACCAAAAACGAATGTTGGGAAAATCCACCCTCTACAGAAATTATTGCCTTCCAACGTTAAAAAGATAAAAGTTCGCCAGATCCTTGAAGGGCAGGACTGG
GAACAGACTTCTCTTGTTCGTCATCATTTCTTCCCCTCTAGGCACCGCCTGAGCCGTACTTCTTGCCGAAGAAGAGGATCTGGAGCTGATCGTAGCCGGA
GAGCACACCAGCACCAGCAATGGCACGGAGGATGTTGGCACCAGCACCCTTGAAGAGAGACTTGGCACCCTCCTTCGCCAGGATCTGCTGGAAAGCATCC
AAGGAGCTCTTGTACTTGACAGCCTCTCCGGAGGTCATCATCATCCTTCTGCGGACGGTGTCAATGGGGTAAGATGCAAGACCGGCACCGTTGGTGATCA
ACCAACCAAGAGCAAAGCTGGCAAAGAAGTTGTCCTGGAGAGTGCCAGTGAGGAGAACGGGCTTCAGAGAATCATACAGTCCAAAGTACAGACCACGGTA
GACAATGATTCCAACACAAGAGATGTTGAATCCACGGTAAAGCCCAGCAATACCATCTGACTTGAGAGTCTTGCGGTAGACATCAACCAGGCCATTGAAT
TGCCTGTCACCTCCACCCTTGGATGCCTTTGCGTCATTGGCCAGCCTTGTCCTAGCATAGTCCAGGGAGTACACGAAGAAGAGCGAGGAAGCACCAGCAG
CACCACCAGAAGCAAGGTTGCCACCGAACCACTTCCAGTAACCATCCTTGTCCTTCTTGAAGTTGAACATCCTCTTGAAGTAATCCTTGAATGCAAAGTT
CAAAGCCTGAGTTGGGAAGTAACGGATGACGTTAGCAGTGTTTCCTCTCCACAATGAGCCAAAGCCTTCATCCTTGATGGTGCGGCCAAAGCAGTCACCA
ATACCCTTGTATGGCTCAGAGAGCCTGCCAGCCTTGATCATCTCATCCTGGTTCTGGATAAGCAGCTTAACACGCTCAATAGGAGCTGCAGCAGTCTTGG
AAACTGCAGCGGACACTCCTCCCATGAGGAAGTCAATTGCAAAGTTCTTGACACCTTTCTTCTCAGGTGGTGCATTGGCAAACAATGGAGAAGATGACAT
CATGGGGACACTGATGCCAAGGTTCTGAGTCATGTAGCAGCTTGTGGTGAAGCGCCTCTCATAGGATGGCACAGAAGGGCAGATGTTGCGAGCACGAACA
CCCTCAGAGAAGCTGGAGGCAAGGTGGAACTGTCCACCAAACTTCTGCATGACAGACGGGTGGTTAGCACGGTCCGCCATCTCTGACCCTTCGGAAGCGG
AGGCGAGGAAGATGGGGTGGTGGCTCTTCCCGGCTCGGCGGCTCCGCTCCTTCCGGTCTTGCGGTGAGAGAGAGAGAG
page-top