Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2635
Contig Information
Length 809 bp
Tissue Root of dessiccated seed
Clones 12 Clones [Download: CSV  ,  FASTA ]
whrd10f05    whrd2o21    whrd12i17    whrd12j13    whrd17a03    whrd18k17    rwhrd10f05    rwhrd2o21    rwhrd4k05    rwhrd12j13    rwhrd17a03    rwhrd18k17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit blue copper-binding protein homolog [Triticum aestivum]
Score 532
Evalue 2.0623e-52
Total Hit Count 463
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2635
CGCTAGCATCAGCATTCAGCAGCACCTCCCTTCTACCTCCTCTGCTTTGCATTCCTCCTTCCGGTTTCAACCGCAATCAATGGCTGCCATGAAGATCACC
CTCCTTGCCGTGGCCGCCTTATTAGGCACCGCGTCAGCGGTAACCTACAACGTCGGCGAGCAGGGCGGTTGGACCCTCAACACCGACTACAGCAGCTGGG
TGTCCGGCAAGAAGTTCAACGTGGGTGATGAGATCGTCTTCAAGTACTCGTCCGCCGCGCACGATGTGGTCGAGGTCAGCAAGGCCGGCTACGACTCCTG
CAGCATCGACGGCGCCATCAACACCTTCAAATCTGGCAACGACGTCATCCCCCTCAGCGCCACCGGCACCCGCTACTTCATCTGCGGCATCACTGGCCAC
TGCAGCCCCACCGCCGCGGCCAGCATGAAGGTCATGATCGACGTCGCCTCGGGCTCCTCTTCGCCTTCCTCACCCATGCCAGCCGCAGGTCCTGGCGCGA
GCAACTCTCCCCCGGCGCCACCCTCCTCCGCCGCTACCTCCGTCGGTGCCACAGCAGGATTTGGCCTCGTCGCCCTACTGGCGGCTGGTCTCATGGCTTG
AACGCATATATTGATCAGCTGCCACGCGCACATATGAGCTTATATATTGTTAACTACTGCTGTAGTCATTATCACGGGTGAATACATGTATTCTTTTTTA
GAGTGAGAATGTGATAGTTACTTGTATCTATCACGTCTATATGTAATCTGCAGACCTTCATGTCTTTTATATAATCATTCTAGAGCATTATTTTATACCA
AAAAAAAAA
page-top