Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2633
Contig Information
Length 987 bp
Tissue Root of dessiccated seed
Clones 12 Clones [Download: CSV  ,  FASTA ]
whrd10b04    whrd5a01    whrd9e15    whrd16h15    whrd17j01    whrd17j02    rwhrd10b04    rwhrd5a01    rwhrd9e15    rwhrd16h15    rwhrd17j01    rwhrd17j02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0169100 [Oryza sativa (japonica cultivar-group)] >gi|122169494|sp|Q0DKF0|RL102_ORYSJ 60S ribosomal protein L10-2 (Putative tumor suppressor SG12) (Protein QM1) >gi|158513181|sp|A2Y0T4|RL102_ORYSI 60S ribosomal protein L10-2 (Putative tumor suppressor SG12) (Protein QM1) >gi|1293784|gb|AAA98698.1| similar to human QM protein, a putative tumor supressor, and to maize ubiquinol-cytochrome C reductase complex subunit VI requiring protein SC34 >gi|113578310|dbj|BAF16673.1| Os05g0169100 [Oryza sativa (japonica cultivar-group)] >gi|215694643|dbj|BAG89834.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767618|dbj|BAG99846.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1085
Evalue 2.19012e-116
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2633
ACTGGGCCAGAATTTTGCTTGTTTCAAGAACGTATAACATTTTCCTGATGTAGCTTCATAAAATGAAGCATCCACCACAGCAAAATACATTGACAAACGA
ATTCAAGCGGCAATGATTCAACAGGCGGTTCATATTAGTACCATCATCACAAAATAGATAATATCTTCCATAACAAGGTTCGACACAACATTCAGACAAA
ATAACATAGCACCACAGGCACTTGGAATCTAAGTTCCACACAGTAAAATAAGTTCTGATAGAACGGATAGACTTCTTCTGCTAGATTATGCGGCAGACAG
GAAAGCTTGTCCAGGGGCACGGTTCGCAAGGCGGCCATGGCATCCGAGCAGCTTAGCGTTGACTCCATCAGGCAAGATCCTGCCCTCACTCTTGAACTTG
AGGTAGTCGTTGCGGTTGAACTTGGTGAAGCCCCACTTCCTGCTCTCAATGATCTTTTGGCGGCCAGGGAACTTGAACTTGGCACGACGAAGGGCCTCAG
TGGCATGGATGGCATTGTTGGGCTTGCACCGCACAGAAAGGAGGACCTGCCCAATGGCAACACGGGCACAGACTCCCTGCGGCTTCCCAAAAGCACCCCT
CATACCAGTCTGGAGCCTATCAGCCCCGGCACACGAAAGCATCTTGTTGATACGGAGCACATGGAACGGGTGAACCCTGACCCTGAGGTGGAAGGCATCC
TTTCCTGCATGCTTGGTCATGTACTTATTGCAAGCAATACGGGCAGCCTCAAGAGCCTCACTGGACACATTCTCCTTCTCCCATGAGACAAGGTGAACAC
AGTGAGAGAACTCGTCGACACCCTTCTTCTTCATGCCAACATCATAGATCCTGATCTTAGGGTCAGGCACACCACGGCAGTACCTTGACTTGGGGTACGG
CTTGTTCTTGATCTGCCGATAGCACCTCGCAGGTCTTCTCCCCATGGCGACGGCGGCTCGAGGCAGGCGGCGGCTGCGGCGGCGGCG
page-top