Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2612
Contig Information
Length 1337 bp
Tissue Root of dessiccated seed
Clones 11 Clones [Download: CSV  ,  FASTA ]
whrd10a22    whrd4f21    whrd5o16    whrd8n16    whrd8n17    rwhrd10a22    rwhrd4f21    rwhrd5o16    rwhrd7j22    rwhrd8n16    rwhrd8n17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Fructose-bisphosphate aldolase cytoplasmic isozyme; AltName: Full=Gravity-specific protein GSC 233 >gi|41398198|gb|AAS05825.1| fructose 1,6-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|50878379|gb|AAT85154.1| putative fructose-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|50878433|gb|AAT85207.1| putative fructose-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|125594188|gb|EAZ34247.1| hypothetical protein OsJ_017730 [Oryza sativa (japonica cultivar-group)] >gi|169244417|gb|ACA50482.1| fructose-bisphosphate aldolase [Oryza sativa Japonica Group]
Score 1720
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2612
TTTTTTTTTTAGAACAAAAACCACCGCTCCGATTTACGATACGCAGCACCCGAGTAACAGGGTATTCGACTCCAAAAACGAAACTACCTAAGCTATTTTG
AGAGCACAAGTTCCATACTAGGTTCGATATCCGAAGGATATATCAAGACTCTGAAAACCAAACGATAATACTGGTAAGCAGGACACCCAAACAGGCCACC
GCACCGAAGGCAGATCAGTACTTGTAGTCCTTGACGTGGAGGCTCTCAGAGGCCCCCTCGCCGAGGGTGGCATCGCCCTTGTAGGTGCCGAGGGTGGCCT
CAGAGTTGGCCTTGCACCTCACCAGGAACGCCTTCCTGGCCTTCTCCTCGTTCTCCACCTTGCCAGCCCAGGCCTTGAGGGTGCTCTGCTGGAGGGCACG
CCCGAAGGAGAAGGACAGGTTCCATGGCTTCTTGGTCTCGAGCTTGTTCATGGCGTTCAGGTTCAGGGTCGCCTCCTCCTCGCTCTGTCCACCAGAGAGG
AAGACAATGGCTGGGACGGCAGCAGGGACAGTCCTCTGGAGGGTGCGGACGGTGTACTCAGCAATCACCTCAGGGGCCACCTTCTTGGCGTCGGATCCAG
GGGTGACCATGTTGGGCTTCAGGAGGGTGCCCTCAAGGAGGACATGCTGGTCGTTGAGGGCCTTGTAGCACGCAGCAAGGACCATCTCAGTCACGTAAGC
ACAGCGGTCAATGTCATGAGGTCCATCAACAAGGATCTCAGGCTCAACAATGGGCACCAGCCCATTCTCCTGGCAGATGATGGCATAGCGAGCCAGACCC
TGAGCATTCTGGTCGATGGAAAGCTGTGATGGCTCGGTGGGGCCAATCTTGAGGACGGCACGCCACTTGGCAAAGCGGGCACCAGCCTCGTAGTACTTGG
CACAGCGCTTGCCAAGGTCATCAAAGCCCTGGGTGGTGGTCTCACCGTTGGTTCCAGCGAGCTCGACGGTACCCTTGTCCACCTTGATGCCAGGGAGGAC
GTTGCCCTCCTTGAGGATGTCAACGAAGGGCTTGCCACCCTTGGTGCTCTGGTACAGTGTCTCCTCAAAGAGGATCACACCACTGAGGTACTGGAGGGCT
CCAGGGGTGCAGAAGAGGAGCTCACGGAGGGCACGGCGGTTGTCCTCAACATTCTCAACATTGATGCTGGCAAAGCGCTTGCCGATGGTGCCGGTGGACT
CGTCGGCAGCAAGGATACCCTTGCCGGGGGTGCCAATGTAGGCAGCGTTCTTGATGAGCTCATCCTTGTACTTTCCGCAGTAGGCCGACATGGTCGATGC
TCGGGGGGATTCGAGAGCGGGGGAGGGAGGGGAGATT
page-top