Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2610
Contig Information
Length 1243 bp
Tissue Root of dessiccated seed
Clones 10 Clones [Download: CSV  ,  FASTA ]
whrd10e04    whrd1m07    whrd4d06    whrd12k02    whrd19a03    rwhrd10e04    rwhrd1m07    rwhrd4d06    rwhrd12k02    rwhrd19a03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytosolic malate dehydrogenase [Triticum aestivum]
Score 1628
Evalue 3.33316e-179
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2610
TCTTCAGCAATGTACTGTCCTGTAAATCATCAGGCAAAAGGGGAGCTACAAGCCTCATTCATACACACTGGGAAAACCAGCGAAAAGGAGCATGCATCGC
GATGTGCGGCTGTTCTGGGTGGAGACGAGAGTTTCTAAGGAGCGGAAGGTTTCATTTATTCAAAACATCCAGAGGAGCAGCTGCCCTTCGAATGTGGATT
TACGCGAGGCATGAGTAGGCCAGCGCCTTCTCCTCCGACAGCTCCTGGGCGGTGGCATCCATCTTCTTCCTCGAGAACTCATCGATCGGGAGCCCTTGAA
CAATTGTCCATTCACCACCACTGCACGTTACTGGGAAGGAGTAGATAAGACCAGCAGGCACACCGTATGAACCATCAGAGTACACACCCATGGAAACAAA
TGTTCCCTCGGCGGTTCCCAGAACCCAGTCACGGATGTGATCACAAGCTGAGCTGGCAGCAGAGAGAGCACTGGAGAGCTTCCTCGCTTTGATGATTGCA
GCACCACGCTGCTGGACAGTGGCAATGAACTCCCCGTTTAGCCATTCATCATCTTGAACAAGTTCACGAACAGGCTTCTCTCCACTGGAAGTCTTCACAG
TGGCGTGGTTAACATCAGGGTACTGACTGGACGAGTGATTACCCCAGATAATAGCATTCTTCACGTCAGAAACTTGGACACCAAGTCTCTCAGAAATCTG
ACCGAGTGCCCTGTTGTGGTCTAGGCGGGTCAAACAACTGATGTTCTTCTCAGGGATAGATGGAGCAAACTCCTTCAGGATGAGAGCATTGGTGTTTGCT
GGGTTGGCAACAACCAAAACCTTGCAGTTGGGGGCTGCATGAGCTTCAAGAGCAGATGCTTGAGCTTTGTAGATTGAAACATTTTTCGTCATAACATCCT
TCCTTTCCATTCCTTCCTTCCTGGGGAATCCACCAACCATAACCGCAACATTCACACCAGTGCAGGCCTCAACAACATCAGTTGTTGCAACAACTCCCTT
GAGAAGTGGAAATGCGGCATCGATCAACTCCATCTTGACGCCTTTAAGAGCTTCAGCAGCAAATTCAATATCCAGCATATGCAGAATAACAGGCTGGTCT
GCACCAAGCATAACTCCCCTGGCAATCATGGGAACAAGAGCATATCCGATTTGTCCTGCGGCGCCGGTGACGAGCACGCGCATCGGTTCCTTCGCCGCCA
TTGGAGCCGGGGGGTAGCTTCTGGACACGGGGATAGGGAGAGT
page-top