Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2584
Contig Information
Length 873 bp
Tissue Root of dessiccated seed
Clones 9 Clones [Download: CSV  ,  FASTA ]
whrd10d21    whrd20k06    rwhrd10d21    rwhrd10o01    rwhrd11l01    rwhrd12m07    rwhrd18f15    rwhrd18i04    rwhrd20k06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit NADP-dependent malic enzyme [Triticum aestivum]
Score 838
Evalue 7.79693e-88
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2584
ATTACACTCGTTTAACTCAATCTGACAAAAGAATCGACGACGACGACGACGACGCACCTCGACACGGATAGACAGGTGCGTGCCGTGCTCCCGTTAACAG
TACATTACAGTACAAAGTAAAGCAAAGTAGAAGAGCACAAGAGTACACATACGCATAGACGGACACAGAAGGAAAGAAAGCCTATGTTTTAGGTTGCGTC
GCTGAAGCTTTGAGTTGAGCTGGTTGGCATACGGGGGAAGGAGATTGATTTTATTGATTGACTCCGTCCGTGCTGGCCGCAAAACTGCCCGCCACGCTCA
CCTGTAGCTGCGGTAGAGCGGGGTGTACATGCAGCTCTCGGCGTACTTGACCAGGTCGTCGGGCCGCGGCAGCCGGCTGGCCAGGCCCAGGTCGTAGGCC
TTGGCGGCCACCTTGGCGGCGATGCTGGCCGAGATCTTGCGGATGTTGGTGAAGGGCGGGAAGATGAGCCCCTTGTCGAAGTTCTCCTGGGTCGCCTCCT
CCGCCAGCGCCTCCGAGGCGGCGAGGAGCATGTCGTCGTGGACGCGGATGGCGCCGGAGATGACGACGCCGAGGCCGAAGCCGGGGAACACGTAGGCGTT
GTTGGACTGCCCGGGCACGAACGTCTTCCCCTCGTACTCCACGGGGTCGAACGGGCTGCCGCTCGCGAACACCGCCGTGCCCTTGCTCCAGGTGTAGGCC
TCCTCGGCCGTGCACTCCGAGTGGGACGTCGGGTTCGACAGCGAGAAGATGACGGGTTTCTCGTTGAAGGAGGCCATGGCCTCGATCACTTCCTGGGTGA
AGGTCTTCCCGACGCCGGAGGTTCCGATCAGCACGGTTGGCTTGATGGACTGGACGGCCTCCAGCAGGGTCTT
page-top