Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2564
Contig Information
Length 567 bp
Tissue Root of dessiccated seed
Clones 8 Clones [Download: CSV  ,  FASTA ]
whrd10e06    whrd10e17    whrd10e18    whrd1g14    whrd1h01    rwhrd10e06    rwhrd10e17    rwhrd1g14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ubiquitin-like protein 5 [Hordeum vulgare]
Score 385
Evalue 1.07397e-35
Total Hit Count 167
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2564
TCTCAATCGAAAAGCACAAGGCCGCTGCAGCTCTCGCCGGGGCTAGGGTTTCGTCGATCGATCGATCAGTCGACGCGAGCGGGAGCGAAGATGATCGAGG
TGGTGCTCAACGACCGCCTGGGGAAGAAGGTGCGCGTCAAGTGCAACGAGGACGACACCATCGGCGACCTCAAGAAGCTCGTGGCGGCGCAGACCGGGAC
CAGGGCCGAGAAGATCCGCATCCAGAAGTGGTACACCATCTACAAGGACCACATCACCCTCGGCGACTACGAGATCCACGACGGCATGGGCCTCGAGCTC
TACTACAACTAGCCTCATCACCCCCGCCATTGCAGGTTCGTCACCTATCGTTGCCTGTGATGAGCGTTGGTTGCATTCCAGTCCCAGTGTCTTCAGAGCT
CGATGTGTGGGCTGAACTCCAGCGAGCTACTATATAAGTAGTGCATTATTGTACCCATGATGATTATTGACAGCCTGAACATACTTTTCCTGTGATCGAC
CTGCGAATCTAATGTGCTGTTACTGTGAAGTTTATAAATAACATAAACTGTGTTACCAAAAAAAAAA
page-top