Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2550
Contig Information
Length 617 bp
Tissue Root of dessiccated seed
Clones 8 Clones [Download: CSV  ,  FASTA ]
whrd10e05    whrd3c05    whrd3c06    whrd3c17    rwhrd10e05    rwhrd3c05    rwhrd3c06    rwhrd3c17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Chain A, Crystal Structure Of Barley Thioredoxin H Isoform 2 In The Oxidized State >gi|186972809|pdb|2VLT|B Chain B, Crystal Structure Of Barley Thioredoxin H Isoform 2 In The Oxidized State >gi|186972810|pdb|2VLU|A Chain A, Crystal Structure Of Barley Thioredoxin H Isoform 2 In Partially Radiation-Reduced State >gi|186972811|pdb|2VLU|B Chain B, Crystal Structure Of Barley Thioredoxin H Isoform 2 In Partially Radiation-Reduced State >gi|186972812|pdb|2VLV|A Chain A, Crystal Structure Of Barley Thioredoxin H Isoform 2 In Partially Radiation-Reduced State >gi|186972813|pdb|2VLV|B Chain B, Crystal Structure Of Barley Thioredoxin H Isoform 2 In Partially Radiation-Reduced State >gi|32186042|gb|AAP72291.1| thioredoxin h isoform 2; HvTrxh2 [Hordeum vulgare subsp. vulgare]
Score 541
Evalue 1.06209e-53
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2550
GCAACAACAAAGTGCGCGTGAGAAATCAACAAGCGGTGCTTGCCGAGAAGAGAGAGAGAGAGATGGCGGCGTCGGCGGCGACGGCAACGGCGGCGGCGGT
GGGGGCGGGGGAGGTGATCTCCGTCCACACCCTGGAGCAGTGGACCATGCAGATCGAGGAGGCCAACGCCGCCAAGAAGCTGGTGGTGGTTGACTTCACT
GCATCATGGTGTGGACCATGCCGCATCATGGCTCCAGTTTTCGCTGATCTCGCCAAGAAGTTCCCAAATGCTGTTTTCCTCAAGGTCGATGTCGATGAAC
TGAAGCCCATTGCGGAGCAATTCAGCGTTGAGGCCATGCCAACCTTCCTGTTCATTAAGGAAGGAGATGTCAAGGACAGGGTTGTGGGAGCTATCAAGGA
GGAACTGACGAACAAGGTTGGGCTACACGCGGCGGCCCAGTAATCACCTAGCGGAGTAGTATTCGCCTAAATAAAATTGTGGCTCAAGAAGCGGTGCCTC
TAATGGCACCTTATATCCTGTGTACTGCTTGTTACTTGTTGGTTGGATGATGGTGAATCAAGTGTGACTTTATTCGGTAAATGGTTGATTTTCATAAGGA
GCTGATCAAAAAAAAAA
page-top