Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2521
Contig Information
Length 1212 bp
Tissue Root of dessiccated seed
Clones 7 Clones [Download: CSV  ,  FASTA ]
whrd10a14    whrd10b01    whrd2p09    rwhrd10a14    rwhrd10b01    rwhrd2p09    rwhrd3d13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_37384 [Oryza sativa Indica Group]
Score 1227
Evalue 1.0175e-132
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2521
TAACGTTAACATATTCGGATACACACTAACAAACAGCATAATTAATTCTTGTTCAAGGTAATAATAGGACTTGGAAAACTTTAGTGTTCAACACTAAACA
AAACTGGCGACTTGAAGGACGGCACACAGCTTAGTCGTCGAACAGGCTGAATCCCATCTCGCCATCTGATTCCTCCTCGGGCTCGTCCTTCTTCTCCTCC
TCCTTAGGGGCAGCGGCGGCAGCACCACCGGAGGCAGCAGCAGCAGGGGCAGCAACGGCAAACTTGCTCGGGTCCTTGAGGTACTCCTTGATCTTATCGG
CATGGTCATATGAGTAGTCTGTCTCCAAAGCAACCGCAAGAACATTCTTGTATGCGTTGAGGAACATGTGCGGCGCAGCAGCCATGGTGGGGTATGAGAT
CGCCAGGGACAGTGAGGCAACCATGGAAACACCAGAAGCAAACTTGTCCATCAGGTCTTCCTCAGTAAGGTCAAGAACCTCAGGGCTGAAGACAGACCCA
CTGTCATAGACATTGCAGATGACCAGTCCATATGAGAAGGGGCGGATACCAAGCTTGGCAAGCAGGGCAGACTCAGAGGAGCCCACCTTGTCACCCTTCT
TGATCAGCTCCACTGGGATAGTAATTTCCACAGTACCCTTGTTAATCTTGGTGGGAATGTTAAGCACCTGGAAGAAGGACGTCTGGGAGGGATCCAGACC
AGTGTTGCCAGGGGGAACCACCACATCAACAGGTGCAACTAGCCCAACACGAGCAGGAGCGCCAACCTTGTACTTGGCGACCTCCTCGCGAACCTCCTTG
AGGTCACCCTTGGTGAAGATGAGGCCAACGTTACCGACGAGGAGGTTGCTGAGCTCAAGGAAGTCCTTGTTGCCGGTCTTCTCCGAGTGCACCTTGATGC
AGCGGCGGATGAGGGTGTTCTTGCCCATGAGCACGATGGAGTCGCCGCGGAGACCCTTGCGGATCTCCTGGAGCTGCTTGGAGCCGACATTGTCGGCGAC
GGCGATGAGCACCTTGGTGTACTCCTCGAGCAGCTGGCAGAGCTTCTGGTCGTACGCGATCTTCTTCTCGGCCTTGGTCCTCTTGATCGCCATCGAAGCA
GCTACGAGATGGACGGAGGCGCTAACGCTAGATTGCTAAGCCTGTGTGGGGGGAGAGAGGCGAGAGGATGAGGACCAGGCTCGGGAGAAGAGCGAGGCGG
ACGGCTGCGGCG
page-top