Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2517
Contig Information
Length 1589 bp
Tissue Root of dessiccated seed
Clones 7 Clones [Download: CSV  ,  FASTA ]
whrd15j09    whrd16h21    whrd19e03    whrd19o02    rwhrd16h21    rwhrd19e03    rwhrd19o02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit phenylalanine ammonia-lyase [Hordeum vulgare subsp. vulgare]
Score 2273
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2517
TCACGGCACGTCCGTGGGCTCTGCGCTCGCGGCCACGGTGCTGTTCGACTGCAACGTCCTTGCTGTTCTCTCCGAGGTCCTGTCCGCCGTCTTCTGCGAG
GTGATGAACGGCAAGCCCGAGTTCACCGACCACCTCACCCACAAGCTCAAGCACCACCCCGGCTCCATCGAGGCCGCGGCCATCATGGAGCACATCCTGG
CCGGCAGCGCCTTCATGGGCCACGCCAAGAAGGTCAACGAGATTGACACGCAGCTCAAGCCCAAGCAAGACAGGTACGCGCTCCGCACGTCGCCCCAGTG
GCTCGGCCCCCAGATCGAGGTCATCCGGTCTGCCACCAAGTCCATCGAGCGCGAGGTCAACTCCGTCAACGACAACCCCGTCATCGACGTCCACCGTGGC
AAGGCGCTCCATGGCGGCAACTTCCAGGGCACACCCATCGGTGTGTCCATGGACAACACCCGTCTCGCCATCGCCAACATTGGCAAGCTCATGTTCGCGC
AGTTCTCGGAGCTCGTCAACGAGTTCTACAACAACGGGCTGACCTCCAACCTGGCAGGCAGCCGCAACCCGAGCCTGGACTACGGCTTCAAGGGCACCGA
GATCGCCATGGCTTCCTACTGCTCTGAGCTCCAGTACCTTGCCAACCCGGTGACCAACCATGTCCAGAGTGCCGAGCAGCACAACCAGGACGTGAACTCT
CTGGGCCTTGTCTCGGCCAGGAAGACCGCCGAGGCTGTGGACATCCTCAAGCTCATGTCCTCCACATACATGGTGGCGCTGTGCCAGGCCATCGACCTCC
GCCACCTGGAGGAGAACATCAAGACCTCCGTGAAGAACTGCGTGACGCAGGTGTCGAAGAAGGTGCTGACCATGAACCCCACCGGCGACCTCTCCAGCGC
GCGCTTCAGCGAGAAGAGCCTCATCACCGCCATCGACCGCGAGGCCGTGTTCAGCTACGCCGACGACGCCTGCAGCGCCAACTACCCACTGATGCAGAAG
CTGCGCGCCGTGCTGGTCGACCACGCCCTGACCGCCGGCCCCGGCGAGGCCGAGAGCGAGGCCACGGTGTTCTCCAAGATCAACAAGTTCGAGGAGGAGC
TGCGGTCGGCCCTGCCGCGGGAGATCGAGGCCGCCCGCGTGGCCTTCGAGAACGGCACCGCGCCCATCCCCAACCTGATCAAGGAGAGCAGGTCGTTCCC
GCTGTACCGCTTCGTCCGCGAGGAGCTCGGCTGCGTGTACCTCACCGGCGAGAAGCTGCTGTCCCCCGGCGAGGAGTGCACCAAGGTCTTCCTGGGCATC
AGCCAGAACAAGCTCATCGACCCCATGCTGGAGTGCCTCAAGGAGTGGAACGGCGAGCCCCTGCCCATCAACGTCTGAAGCATCGTCCGCGCCACCGTGG
AGGAGAGGAGGAGGAGGAGGCTTCCAGAGTACATCCAAAAATAAGACGCTTAATTCGTTCGTGCATGTTCTTCTTCTTCAGTTCCTATCGCCTTTTGCCT
TTCGTTGTTCGTGCGTTGGTGTTGATCGACGTGTGGCGTTGTTGTTGATTGTGTAGCTGCTCTGCCGCAGCTTTACCTAAAGATATTGT
page-top