Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig2516
Contig Information
Length 1425 bp
Tissue Root of dessiccated seed
Clones 7 Clones [Download: CSV  ,  FASTA ]
whrd10d23    whrd10d24    whrd4a23    whrd20i24    rwhrd10d24    rwhrd4a23    rwhrd20i24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_23352 [Oryza sativa Indica Group]
Score 1571
Evalue 1.64325e-172
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig2516
TTTGATGAGTTACTATTACTGAAAAGAGGAGGCCAGGTAATATACTCTGGGAAACTGGGTCGCAACTCACAGAAAATGACTGAATACTTCGAGGCGATTC
CTGGAGTGCCTAAAATCAAAGATAAGTACAACCCTGCAACGTGGATGCTTGAGGTCAGTTCAGTTGCTGCAGAAGTACGCCTGAGTATGGATTTTGCTGA
CTACTACAGGACTTCAGATCTGTACAAGCAAAACAAGGTATTGGTGAGCCAGCTAAGTCGACCAGAACCAGGAACATCAGATCTGTATTTTCCTACAGAA
TACTCGCAATCCATTATAGGGCAGTTCAAAGCCTGCCTCTGGAAGCATTGGCTGACCTATTGGCGCAGCCCAGATTACAACCTTGTCAGATTTTCCTTCA
CTTTGTTCACAGCCTTGCTGCTGGGCTCCATCTTTTGGAAGATTGGCACCAATATGGGGGATGCCAATACTCTTAGAATGGTCATTGGAGCAATGTACAC
AGCAGTGATGTTTGTCGGCATCAACAACTGTGCAACCGTTCAACCAATTGTTTCAATCGAGAGAACAGTTTTCTACCGAGAGAGGGCTGCTGGGATGTAC
TCTGCACTGCCATATGCCATTGCTCAGGTTGTCATGGAGATACCTTATGTCTTCGTCCAAACCTCGTATTACACCCTCATCGTATACGCCATGATGAGCT
TCCAGTGGACAGCTGTCAAGTTCTTCTGGTTCTTCTTCGTCTCCTACTTTTCCTTCCTCTACTTCACCTACTACGGGATGATGACTGTATCAATCTCACC
AAACCATGAGGTTGCAGGCATCTTCGCCGCAGCTTTCTATTCCCTATTCAACCTTTTCTCTGGCTTCTTCATCCCAAGACCGAAAATCCCCAAATGGTGG
ATCTGGTACTACTGGATTTGCCCATTGGCATGGACAGTGTATGGGCTCATAGTGACACAATACGGAGACATGGAAGACATCATCACCGTCCCAGGCCAAT
CTAACCAGACAATCAGCTACTACATAACACATCATTTTGGATACCACAGGAGCTTCATGGCGGTCGTTGCACCGGTGCTTGTGCTCTTTGCAGTGTTCTT
CGCTTTCATGTATGCTCTCTGCCTCAAGAAGTTGAACTTTCAAACACGGTAGGAGCGGAAAGCCAACAGACAAGATCTCACAGGCAATATGGTCGATTTT
TCTTGATCCAACTCTTCTTTTGTCCTTCCATTTTTGGGTCTATTTATGTGCCAGTGTAAATACAGGTGTAGTTTTTTGGATTCCTTACATAGTCAAATAC
GATGAGGGTGCACCAGCCTTTCAGGCTTGGAAGTGTATTGCATTGCAAATTTGCAAGACTGCGATGAGCAGAATTTGTTCATGGCCTATAAATACATTGG
AGTTTTTTCTTTCACAAAAAAAAAA
page-top